Zygote - embryogenesis, Biology

Assignment Help:

Zygote - Embryogenesis

The fertilized egg or zygote is situated at the micropylar end/pole of the embryo sac, its basal (micropylar) end is attached to the embryo sac wall and apical (chalazal) part projects into the central cell. The zygote usually undergoes a period of rest during which it shrinks. This resting period of the zygote varies with different species and is to some extent dependent on environmental conditions e.g. in Theobroma cacao the zygote divides 14 to 15 days after fertilization, in Oryza saliva zygote divides about 6 hours after fertilization.

A complete cell wall is formed around the zygote. (You would dl that the egg has only plasmalemma and no wall at its apical part). A TEM picture shows that zygote cytoplasm show a more polarized appearance and that is the two poles appear different, micropylar part is vacuolate and chalazal part with a prominent nucleus.


Related Discussions:- Zygote - embryogenesis

Antimicrobial barriers - proliferation of microorganisms, Q. Antimicrobial...

Q. Antimicrobial Barriers -  proliferation of microorganisms? The first barrier is the integument: a physical barrier to protect the food, e.g., the shell on eggs, the skin on

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

PROTOZOA., WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?

WHAT ARE THE ADVANTAGES & THE DISADVANTAGES OF PROTOZOA?

Bacteria, wine turns sour beause of the action of which bacteria? aerobic o...

wine turns sour beause of the action of which bacteria? aerobic or anerobic?

Outbreak of staphylococcal food poisoning, Q. Outbreak of Staphylococcal f...

Q. Outbreak of Staphylococcal food  poisoning? Conditions necessary for outbreak of Staphylococcal food poisoning: • Presence of viable staphylococcal bacteria in the food

Captive breeding - measures for species conservation, Captive Breeding - Me...

Captive Breeding - Measures for Species Conservation Species which are reduced to dangerous levels need more intensive management, and one strategy is their captive breeding.

What is counselling for diabetic patient, Q. What is counselling for diabet...

Q. What is counselling for diabetic patient? The word counselling has been understood in a number of ways. Counselling can be understood as "consultation, mutual interchange

How is the nervous system of molluscs organized, How is the nervous system ...

How is the nervous system of molluscs organized? Molluscs have well-developed sensory structures. It is established that cephalopods, such as squid and octopus, have eyes with

Bees, is there a difference between the giant asiatic bees apis dorsata and...

is there a difference between the giant asiatic bees apis dorsata and Philippine giant bees apis breviligula

What is drugs, What is drugs? Intravenous access must be established. A...

What is drugs? Intravenous access must be established. Although administration of drugs through a central vein is ideal in a low cardiac output situation, it is rarely possible

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd