Zoology, biology, Biology

Assignment Help:
living and non living

Related Discussions:- Zoology, biology

Oxidation of glyceraldehyde-3-phosphate, Oxidation of glyceraldehyde-3-phos...

Oxidation of glyceraldehyde-3-phosphate Oxidation of glyceraldehyde-3-phosphate : The  conversion  of glceraldehyde- 3-phosphate to  1,3-bisphosphoglycerate  is catalysed  by

Control and informative function of organic molecules, Q. What are the few ...

Q. What are the few examples of the control and informative function of organic molecules? Based on genetic information, organic molecules control the entire work of the cell. D

To observe yeast plants, To observe yeast plants Borrow a microscope fr...

To observe yeast plants Borrow a microscope from a college, a high school, a doctor or a hospital. Place a some drops of the sugar solution which having yeast on a glass slide

Drugs and insulin used in diabetes, Q. Drugs and Insulin used in diabetes? ...

Q. Drugs and Insulin used in diabetes? When diet, exercise or even weight reduction do not improve the diabetic symptoms and blood sugar levels, the uses of hypoglycemia drugs

What is name for interruptions for myelin sheath, In most axons, myelin she...

In most axons, myelin sheath is interrupted at intervals of about 1 millimeter or more. These interruptions are known as: a) Collaterals b) Nodes of Ranvier (pron: ron-vee-ay)

Reproduction, site of fertilistion in human

site of fertilistion in human

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Dietetic foods for diabetes, Dietetic Foods for diabetes: With advances...

Dietetic Foods for diabetes: With advances in food technology, foods for special use by diabetics are now available in the global market, they are emerging in India also. These

Acute rheumatic fever, Acute Rheumatic Fever   Rheumatic  fever is an i...

Acute Rheumatic Fever   Rheumatic  fever is an inflammatory disease that usually follows infection of upper respiratory tract with group A beta hemolytic streptococci. It  is c

Define iodothyronine deiodinases - functions of selenium, Define Iodothyron...

Define Iodothyronine Deiodinases - functions of selenium in humans? Another group of selenoproteins are the iodothyronine deiodinases essential for the conversion of thyroxine

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd