Zoology, biology, Biology

Assignment Help:
living and non living

Related Discussions:- Zoology, biology

What is the phase of the menstrual cycle, In general what is the phase of t...

In general what is the phase of the menstrual cycle when copulation may lead to fecundation? Although this is not a rule, to be effective fecundation in general must happen wit

Intracellular digestion, Intracellular Digestion We all know that unic...

Intracellular Digestion We all know that unicellular organisms do not have a separate alimentary canal system. All the functions of life are carried out inside a single cell.

Define reagents required and methodology for mucic acid test, Define Reagen...

Define Reagents Required and Methodology for Mucic Acid Test? -   Sugar solution -   Conc. Nitric acid Methodology Take about 50 mg of sugar in a test tube. Add 1 ml

Lipid profile, Abnormalities in the lipid profile are found in patients wit...

Abnormalities in the lipid profile are found in patients with diabetes mellitus. The lipid abnormalities increase the risk of heart disease in diabetics and hence should be regular

Food gathering and hunting , Food Gathering and Hunting : Food Gatherin...

Food Gathering and Hunting : Food Gathering and Hunting In order to live, man needed to eat and to protect himself from the weather and animals.  For both purposes he found it

State the posterior superior alveolar nerve, Posterior superior alveolar ne...

Posterior superior alveolar nerve and vessels It is found in the  posterior aspect of the maxilla running between the bone and the lining of the maxillary sinus may be injured

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Homework, 1) a) Initially, how do skeletal muscles (the type of muscle atta...

1) a) Initially, how do skeletal muscles (the type of muscle attached to bones) make ATP? b) write the reaction for this procss (Crp +ADP => Cr + ATP) as a ''coupled'' reaction, id

Diversity in living organisms.., labelled diagram of male and female cockro...

labelled diagram of male and female cockroach with difference between them

What gases was the earths primitive atmosphere, Before the emergence of lif...

Before the emergence of life of what gases was the earth's primitive atmosphere constituted? The earth's primitive atmosphere was basically produced of methane, hydrogen, ammon

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd