Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Oxidation of glyceraldehyde-3-phosphate Oxidation of glyceraldehyde-3-phosphate : The conversion of glceraldehyde- 3-phosphate to 1,3-bisphosphoglycerate is catalysed by
Q. What are the few examples of the control and informative function of organic molecules? Based on genetic information, organic molecules control the entire work of the cell. D
To observe yeast plants Borrow a microscope from a college, a high school, a doctor or a hospital. Place a some drops of the sugar solution which having yeast on a glass slide
Q. Drugs and Insulin used in diabetes? When diet, exercise or even weight reduction do not improve the diabetic symptoms and blood sugar levels, the uses of hypoglycemia drugs
In most axons, myelin sheath is interrupted at intervals of about 1 millimeter or more. These interruptions are known as: a) Collaterals b) Nodes of Ranvier (pron: ron-vee-ay)
site of fertilistion in human
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Dietetic Foods for diabetes: With advances in food technology, foods for special use by diabetics are now available in the global market, they are emerging in India also. These
Acute Rheumatic Fever Rheumatic fever is an inflammatory disease that usually follows infection of upper respiratory tract with group A beta hemolytic streptococci. It is c
Define Iodothyronine Deiodinases - functions of selenium in humans? Another group of selenoproteins are the iodothyronine deiodinases essential for the conversion of thyroxine
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd