Write a short note on muscular system, Biology

Assignment Help:

Write a short note on muscular system?

The muscular system provides mobility and support to the body. There are three types of muscle tissue: skeletal, smooth, and cardiac. These vary in structure according to their function. Skeletal muscles are striated muscles that serve to move body parts. Smooth muscles is found in internal organs, while cardiac muscle is present only in the heart. Muscle filaments and filaments similar to those found in muscles are responsible for most of the movements of protoplasm in the body.


Related Discussions:- Write a short note on muscular system

Systmetic, Relation between taxonomy and ecology

Relation between taxonomy and ecology

Describe class ophiuroidea in general way, Describe Class Ophiuroidea in ge...

Describe Class Ophiuroidea in general way? Brittle stars have a central disc with five long, thin, flexible arms that can be detached from the body at will in times of danger.

Biochemical, Explain the salient features biochemical origin of life.

Explain the salient features biochemical origin of life.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Zooology, green gland is excretory organ of which orthopodic phylem

green gland is excretory organ of which orthopodic phylem

Homopolysaccharides, HOMOPO L YSACCHARIDE S (= HOMOGLYCANS) These...

HOMOPO L YSACCHARIDE S (= HOMOGLYCANS) These are complex carbohydrats that are formed by repeated condensation or polymerisation of only one type of monosaccharide monome

Science as a human endeavour, Science as a human endeavour: Science is...

Science as a human endeavour: Science is a human endeavour. Human beings, from prehistoric times, attempted to control nature for their own welfare. For this, they had to ob

Scope of biology, SCOPE OF BIOLOGY- Present century is witnessing ex...

SCOPE OF BIOLOGY- Present century is witnessing explosion of information in modem biology directly related to life and health. Issues like global warming, pollution, populat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd