Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Write a short note on muscular system?
The muscular system provides mobility and support to the body. There are three types of muscle tissue: skeletal, smooth, and cardiac. These vary in structure according to their function. Skeletal muscles are striated muscles that serve to move body parts. Smooth muscles is found in internal organs, while cardiac muscle is present only in the heart. Muscle filaments and filaments similar to those found in muscles are responsible for most of the movements of protoplasm in the body.
Relation between taxonomy and ecology
Describe Class Ophiuroidea in general way? Brittle stars have a central disc with five long, thin, flexible arms that can be detached from the body at will in times of danger.
make assignment multiple alleles
Explain the salient features biochemical origin of life.
what is the first to develop in excretory system?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
green gland is excretory organ of which orthopodic phylem
HOMOPO L YSACCHARIDE S (= HOMOGLYCANS) These are complex carbohydrats that are formed by repeated condensation or polymerisation of only one type of monosaccharide monome
Science as a human endeavour: Science is a human endeavour. Human beings, from prehistoric times, attempted to control nature for their own welfare. For this, they had to ob
SCOPE OF BIOLOGY- Present century is witnessing explosion of information in modem biology directly related to life and health. Issues like global warming, pollution, populat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd