Why two atoms always represent the same element, Biology

Assignment Help:

Two atoms always represent the same element if they have. A) the same number of particles in the nucleus. B) The same number of electrons. C) The same number of shells. D) The same number of protons. E) The same mass number.


Related Discussions:- Why two atoms always represent the same element

Explain deformaties of the cliest wall should be noted, Explain Deformaties...

Explain Deformaties of the Cliest wall should be Noted a) Pectus carinatum (pigeon chest): may be associated with Marfan syndrome. b) Pectus excavatum: commonly seen in Marfan

Effect on microbial growth and activity, Effect on Microbial Growth and Act...

Effect on Microbial Growth and Activity Bacteria require higher aw for growth than fungi. Gram-negative bacteria have higher requirements than gram positives. Most spoilage ba

Xerarch - kinds of succession, Xerarch - Kinds of Succession When the ...

Xerarch - Kinds of Succession When the succession takes place in drier area, i.e., the succession progresses from xeric to mesic conditions. It is further subdivided as:

Explains the difference among dominant and recessive alleles, Which of the ...

Which of the following best explains the difference among dominant and recessive alleles? A. The recessive allele encodes a protein with normal activity whereas the dominant al

How to obtain the absorbance of a stationary culture, If a spectrophotomete...

If a spectrophotometer can read accurately within the range of 0.1-1.0 optical density units, then how can you obtain the absorbance of a stationary culture (which may have an A550

Segments that form the body of the tapeworm, Q. What are the segments that ...

Q. What are the segments that form the body of the tapeworm called? What is their function? The body of the tapeworm is made of segments called as proglottids. The proglottids

Determine the sexual arousal mechanism, How does the sexual arousal mechani...

How does the sexual arousal mechanism in women facilitate fecundation? During sexual arousal in women the vagina secretes substances to neutralize its acidity therefore allowin

Reed-swamp stage - hydrarch, Reed-Swamp Stage - Hydrarch This stage is...

Reed-Swamp Stage - Hydrarch This stage is also known as amphibious stage, as the plants of the community are rooted but most parts of their shoots remain exposed to air. Speci

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd