Why should posterior wall preffered during surgery, Biology

Assignment Help:

Why should Posterior wall preffered during surgery

Posterior wall should not be perforated during surgery. This limits bleeding from the pterygoid plexus or branches of the maxillary artery (Posterior superior alveolar artery) as complications. Medial wall separates the sinus from the nasal fossa. The maxillary ostium which drains the sinus into the middle meatus of the nasal cavity is located in the highest, most medial aspect of the sinus wall. Although its high location makes dependant drainage (causing increased susceptibility to infection) difficult, its location is favourable for the implant surgeon in that, it is unlikely to become obstructed by the routine maxillary augmentation in the inferior sinus region.

 


Related Discussions:- Why should posterior wall preffered during surgery

What is the typical vegetation of the grasslands, What is the typical veget...

What is the typical vegetation of the grasslands? Grasslands are mostly formed of herbaceous (nonwoody) vegetation: grass, bushes and small trees. Biomes - Image Diversity:

Cytoplasmic bridge formed during the conjugation of paramoec, Cytoplasmic b...

Cytoplasmic bridge formed during the conjugation of paramoec: The two paramoecia that undergo conjugation are called conjugants. During conjugation, the two conjugants com

Define the term - stimulus, Define the term - Stimulus Stimulus and res...

Define the term - Stimulus Stimulus and response characteristics of the tests themselves, as well as of the test instructions, become exceedingly important considerations. In g

State the transmission of visual sensation, State the Transmission of Visua...

State the Transmission of Visual Sensation This process takes place in the visual pathway from the retina to the visual cortex. 'The impulse originating in the retina travels a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain capillaries of the vascular system, Q. What are the capillaries of ...

Q. What are the capillaries of the vascular system? Capillaries are small blood vessels that perform exchange of substances between the tissues and blood the body Capillaries a

Define basic instruments used in biochemical laboratories, Basic Instrument...

Basic Instruments /Equipment Used In biochemical laboratories and important Working tips The first practical in this manual will orient you to the various equipment, apparatuses

How is price mechanism or supply and demand concerned, How is price mechani...

How is price mechanism or supply and demand concerned?   The price mechanism or supply and demand: The price mechanism or supply and demand is concerned with how buyers

Monosaccharides, MONOSACCHARIDES Simple carbohydrate monomers, whi...

MONOSACCHARIDES Simple carbohydrate monomers, which cannot be hydrolysed further into simpler or smaller subunits. Monosaccharides are generally colourless, crystallin

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd