Why does the urinary volume increase, Biology

Assignment Help:

Why does the urinary volume increase when alcoholic beverages are ingested?

Alcohol inhibits the ADH (antidiuretic hormone) secretion by the hypophysis. Low ADH decreases the tubular resorption of water in the kidneys and thus the urinary volume enhances.

 


Related Discussions:- Why does the urinary volume increase

Digestive system - tongue, TONGU E - On the tongue 4 types of p...

TONGU E - On the tongue 4 types of papillae are present. (i) Filliform - Filliform papillae are most abundant and have no taste bunds. Filliform papillae

How hiv infection works, How do antibody-based tests detect how HIV infecti...

How do antibody-based tests detect how HIV infection works? After the infection by the HIV the immune system starts the production of antibodies (primary immune response) again

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Endosperm of gymnosperms and the endosperm of angiosperms, How dissimilar a...

How dissimilar are the endosperm of gymnosperms and the endosperm of angiosperms? In the gymnosperms the endosperm is haploid (n), it is called as primary endosperm. In the ang

Vitamins requirements for ulcerative colitis, Q. Vitamins requirements for ...

Q. Vitamins requirements for ulcerative colitis? Vitamins: Commercial multivitamin preparation should be administered orally especially the ones needed for the healing process

Reasons for increasing popularity of dental implants, Q. Reasons for increa...

Q. Reasons for increasing popularity of dental implants? There are various reasons for increased popularity of dental implants. With the rapid development and evolution of impl

Emergency room management, Emergency Room Management Patient may needs...

Emergency Room Management Patient may needs incubation and ventilatory support till such time that patient is able to breathe normally. In some cases: patient is admini

Explain about hydroxyapatite coating, Hydroxyapatite coating Hydroxyapa...

Hydroxyapatite coating Hydroxyapatite coating has been recommended for clinical use. These implants are superior with respect to the degree and rate of fixation in the bone as

What roles do membrane proteins play in transporting, What roles do membran...

What roles do membrane proteins play in transporting only certain substances into a cell? Some proteins form channels or pores by which certain substances can pass. Other pr

Define sporangiophore - types of hyphae, Define Sporangiophore - Types of H...

Define Sporangiophore - Types of Hyphae? Sporangiophore - Tufts of special, erect unbranched, hyphae growing in air arise from stolon just opposite to rhizoids. These are s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd