Why do vestigial structures persist in modern organisms, Biology

Assignment Help:

Why do vestigial structures persist in modern organisms?

Explain the evidence that indicates that species evolve over time.

The environment will not select for or against organisms that have a particular structure until that structure affects the organisms' fitness.

Fossils show that a group of organisms, like marine mammals, have changed over time to adapt to dissimilar environments.

 


Related Discussions:- Why do vestigial structures persist in modern organisms

Oogenesis, in human and mammals how many cells result from oogenesis

in human and mammals how many cells result from oogenesis

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the metabolic rate of aerobic organisms, Why can the consumption of...

Why can the consumption of molecular oxygen indicate the metabolic rate of aerobic organisms? Molecular oxygen (O2) consumption has direct relation to the cell metabolic rate i

Epilimnion - summer stratification, Epilimnion - Summer Stratification ...

Epilimnion - Summer Stratification This forms the upper layer of the lake and consists of freely- circulating warm water which is well lighted though poor in nutrients. Most o

Define the parathyroid gland cells, Which of the following serves as a sens...

Which of the following serves as a sensor, or as part of a sensor, that functions in a negative feedback system? A. CaSRs (Calcium-Sensing Receptors) located in the plasma memb

Control and informative function of organic molecules, Q. What are the few ...

Q. What are the few examples of the control and informative function of organic molecules? Based on genetic information, organic molecules control the entire work of the cell.

Verify that the transforming agent in a bacteriophage, Which of the followi...

Which of the following experimental steps permitted Hershey and Chase to verify that the transforming agent in a bacteriophage is DNA as well? A. Phage particles were mixed wit

Cleavage of fructose-1, Cleavage of fructose-1,6-bisphosphate Aldolase...

Cleavage of fructose-1,6-bisphosphate Aldolase cleaves  fructose-1, 6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde-3-phosphate in the reversible reaction.

Explain armamentarium, Armamentarium 1. Denture duplicator or a modifie...

Armamentarium 1. Denture duplicator or a modified plastic soapdish. (A plastic large soapdish with a base and cover can be adapted by drilling 2 mm holes interspersed and cover

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd