#white blood cell, Biology

Assignment Help:
#White blood cell has mainly 5 types right? which is Neutrophil,Monocytes,lymphocytes, basophil and Eosinophil? I wwanted to know is phagocytes a white blood cell, if yes then why because i searched the internet and it stated that neutrophil,Eosinophil and monocytes are phagocytes which means that phagocytes cannot be a white blood cell unless phagocytes is a name for representing neutrophil,Eosinophil and monocytes. And what is granulocytes ?

Related Discussions:- #white blood cell

Define about the chemotherapy, Define about the Chemotherapy - Cancer? ...

Define about the Chemotherapy - Cancer? Chemotherapy results in lot of side effects. This is because the drug effects are not specific to cancer cells alone. Even the host cell

Ecology, Ecology Very often a word has a precise well-defined meaning i...

Ecology Very often a word has a precise well-defined meaning in scientific literature but is loosely used in everyday language. It is, therefore, necessary for you to be clear

Define the intracellular cyclic amp, Define the intracellular cyclic AMP ...

Define the intracellular cyclic AMP Healthy Person P takes a drug that makes a strong effect on the epithelial cells of the kidney collecting duct within one hour and lasts fo

Bones, which bone forms the non-moving muscle attachment in the hip joint

which bone forms the non-moving muscle attachment in the hip joint

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

After the blastula stage what is the next stage, Q. After the blastula stag...

Q. After the blastula stage what is the following stage of the embryonic development? What is the passage from blastula to the next stage called? The blastula turns into gastru

Feeding on liquids, Feeding on Liquids Animals feeding on liquids are...

Feeding on Liquids Animals feeding on liquids are generally highly specialised for their feeding habits. Certain protozoa, endoparasites and aquatic invertebrates take up nut

Explain the terms - sulphur and boron, Sulphur and Boron Boron is extra...

Sulphur and Boron Boron is extracted with hot water. Sulphur is extracted with 500 ppm solution of P solution (prepared from potassium dihydrogen orthophosphate or monocalcium

Kinds of hermaphroditism, Kinds of Hermaphroditism Depending upon the...

Kinds of Hermaphroditism Depending upon the timing of maturity of the gonads, hermaphroditism can be of two types 1. Simultaneous hermaphroditism . Both male and female g

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd