Which substance starts clotting in humans after a wound, Biology

Assignment Help:

When a wound occurs in humans, platelets in the blood activate a substance that starts clotting process. The substance which starts clotting is:

a) Adenosine (pron: ah-den-ah-seen)

b) Thrombin

c) Lecithin (pron: less-ah-thin)

d) Histamine

ANSWER: B - Thrombin

 


Related Discussions:- Which substance starts clotting in humans after a wound

What do you mean by cancer, Q. What is cancer? The Cancers are malign n...

Q. What is cancer? The Cancers are malign neoplasias that is abnormal and uncontrolled proliferation of cells that can disseminate to other sites of the body. The Cancer dissem

What is the function of the left ventricle, What is the function of the lef...

What is the function of the left ventricle? Where does the blood go after leaving the left ventricle? The function of the left ventricle is to get blood from the left atrium an

What do you mean by insect control, Q. What do you mean by Insect control? ...

Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed

Biostatistic.., biostatistical application in biotechnology

biostatistical application in biotechnology

Name the animal who have its own dna, Which one of the following has its ow...

Which one of the following has its own DNA? 1. Mitochondria 2. Dictyosome 3. Lysosome 4. Peroxisome Mitochondria

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Sponges, Ask qimporatance of sponge in tourism industry

Ask qimporatance of sponge in tourism industry

Chordates and non chordates, give an account of ciliary and flagellar move...

give an account of ciliary and flagellar movement in protozoa

Define translation phase of gene expression process, Define Translation Pha...

Define Translation Phase of gene expression process? The NDA which the transcript into m RNA is translated into protein with the help of ribosomes, m RNA, amino acids, a number

What is etiopathology, Q. What is Etiopathology? Who is likely to devel...

Q. What is Etiopathology? Who is likely to develop gout? What are the risk factors? Let us find out. Gout is caused when there is over production of uric acid in normal purine

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd