Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
When a wound occurs in humans, platelets in the blood activate a substance that starts clotting process. The substance which starts clotting is:
a) Adenosine (pron: ah-den-ah-seen)
b) Thrombin
c) Lecithin (pron: less-ah-thin)
d) Histamine
ANSWER: B - Thrombin
Q. What is cancer? The Cancers are malign neoplasias that is abnormal and uncontrolled proliferation of cells that can disseminate to other sites of the body. The Cancer dissem
What is the function of the left ventricle? Where does the blood go after leaving the left ventricle? The function of the left ventricle is to get blood from the left atrium an
Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed
biostatistical application in biotechnology
Which one of the following has its own DNA? 1. Mitochondria 2. Dictyosome 3. Lysosome 4. Peroxisome Mitochondria
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ask qimporatance of sponge in tourism industry
give an account of ciliary and flagellar movement in protozoa
Define Translation Phase of gene expression process? The NDA which the transcript into m RNA is translated into protein with the help of ribosomes, m RNA, amino acids, a number
Q. What is Etiopathology? Who is likely to develop gout? What are the risk factors? Let us find out. Gout is caused when there is over production of uric acid in normal purine
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd