Where do the photochemical stages of photosynthesis occur, Biology

Assignment Help:

Where do the photochemical and the chemical stages of photosynthesis occur?

The photochemical stage of the photosynthesis process happens mainly on the thylakoids (the green part) and the chemical stage happens in the stroma (the colorless framework) of the chloroplasts.

 


Related Discussions:- Where do the photochemical stages of photosynthesis occur

Reproduction, what is the difference between anisogamy and oogamy?

what is the difference between anisogamy and oogamy?

Explain the s1m filament theory of muscle contraction, Explain the s1M fila...

Explain the s1M filament theory of muscle contraction. What is special of "FlavrSavr" variety of tomato? Why is it preferred to its normal native variety? Illustrate a label

Admission to the hospital - nursing, Admission to  the Hospital The ...

Admission to  the Hospital The  philosophy of  childcare, whether in the home, hospital, or  other community agency, should be consistently one of concern and support for the

Explain the expansion of the universe, Using the Raisin Bread model from th...

Using the Raisin Bread model from the textbook, describe the expansion of the universe. Do the galaxies expand also?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which hormones secreted by adrenal medulla, Q. What are the hormones secret...

Q. What are the hormones secreted by the adrenal medulla? What are their respective functions? The medullary portion of the adrenals secretes hormones of the catecholamine grou

Explain the types of double beam systems, Explain the types of double beam ...

Explain the types of double beam systems? Following are types of double beam systems: a) Dual beam in space type b) Dual beam in time type In type (a) separate detecto

What is dynamic auscultation in heart surgery, What is Dynamic Auscultation...

What is Dynamic Auscultation in heart surgery? It involves determining the effects on heart sounds and murmurs of various physiological and pharmacological manoeuvres, which al

Why is an s strain of bacteria able to cause disease, Why is an S strain of...

Why is an S strain of bacteria able to cause disease in mammals but a R strain is not? The slippery capsule stops the cells of the defence system from capturing and destroying

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd