Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Staphylococci exist in air, dust, sewage, water, milk and food or on food equipment, environmental surfaces, humans and animals. Humans and animals are the primary reservoirs. Staphylococci are present in the nasal passages and throats and on the hair and skin of 50 percent or more of healthy individuals. A wide range of foods maybe involved in Staphylococcal food poisoning including ham, turkey, chicken and chicken salad, baked products, especially filled pastries, table ready-meats (sausage etc.), precooked frozen foods and dairy products.
S. aureus cells are relatively more resistant than many gram negative food spoilage organisms. Human intoxication is caused by ingesting enterotoxins produced in food by strains of S. aureus, usually because the food has not been kept hot enough (60ºC, or above) or cold enough (7.2ºC, or below). In frozen foods they may survive even at -10ºC. In general, survival of S. aureus is best in foods that contain high concentration of sugars, eggs and buffering component such as phosphates and protein. Salt concentration less than 9.5%, temperature more than 20ºC and a pH in the range 6-8 are favourable for growth and enterotoxin formation.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What do you understand by Mesocoel? The middle of three coelomic spaces found in tripartate body plan characteristic of deuterostome lineage of animals. Other coelomic compartm
Explain Research dietitians Research dietitians work in the field of normal or therapeutic nutrition Research dietitians seek ways to improve the nutrition of both healthy
natural selection
Syngamy and Triple Fusion After traversing through the stylar region, the ultimate destination of the pollen tube is to reach the female gametophyte and release the male game
What is the cost-benefit relationship regarding sewage treatment as a method to fight water pollution? To treat sewage is much cheaper for society. The non treated sewage pollu
Stratification - Aquatic ecosystems Aquatic ecosystems also exhibit marked stratification. In lake and ocean ecosystems light penetration, temperature and availability of oxyg
Technique: Careful re-opening of sternum and release of steinum from the underlying adhesion is done. Femoral artery and vein are exposed for going on femoro fenioral bypass
Q What are some examples of tissues and organs where mitosis is more frequent, less frequent or practically absent? Generally in vertebrates mitosis is more frequent in tissues
Q. Show the Valuation of Biodiversity? Serious research in this field has only been recently initiated and the methodologies for valuation are still evolving. Important valuat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd