Whatever is complementary to this, Biology

Assignment Help:

What does it mean when a plasmid is cleaved with Hind III and Sca I? Does that mean that it opens up at those two locations and I have to insert whatever is complementary to it?


Related Discussions:- Whatever is complementary to this

Describe the advantages and disadvantages of insulin pump, Describe the Adv...

Describe the Advantages and Disadvantages of insulin pump Advantages - Insulin pumps deliver more precise amounts of insulin. This supports control over blood sugar level,

How substrate concentration affect the enzymatic reaction, How does the sub...

How does the substrate concentration affect the speed of enzymatic reactions? Initially as substrate concentration increases, the speed of the reaction enhances; this happens b

How are antivenoms produced, How are antivenoms produced? Why are antivenom...

How are antivenoms produced? Why are antivenoms an example of passive immunization? Antivenoms are getting by the following process: the venom (antigen) is inoculated into othe

Urea molasses mineral block (ummb) licks, Urea molasses mineral block (UMMB...

Urea molasses mineral block (UMMB) licks Development of urea molasses mineral block licks is another technology being increasingly used in several parts of India and such lick

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are enzyme cofactors, What are enzyme cofactors? Some enzymes requ...

What are enzyme cofactors? Some enzymes require other associated molecules to work. These molecules are known as enzyme cofactors and they can be, for example, organic ions lik

Stratification, Stratification On the basis of the variation in air tem...

Stratification On the basis of the variation in air temperature. the atmosphere has been divided vertically into four layers: (figure shown below) thee troposphere, stratospG,

What is the most likely source of error in the study, In a cohort study tha...

In a cohort study that found an association between alcohol consumption and bladder cancer, 20,000 middle-aged men were asked about their drinking habits and then tracked for five

Bacteria, write six characteristics of bacteria

write six characteristics of bacteria

Forebrain - cerebrum, CEREBRU M - Largest part of brain. 2/3 of bra...

CEREBRU M - Largest part of brain. 2/3 of brain. 4/5 of brain's weight. Cerebrum is devided into 2 cerebral hemispheres by longitudinal cerebral fissure. Gyri and sul

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd