What will happen without enough insulin, Biology

Assignment Help:

Q. What will happen without enough insulin?

Without enough insulin two things can happen. Firstly, the cells of the body will be unable to use the glucose in the blood for energy. Secondly, glucose cannot be converted to glycogen in the liver for future use. Thus blood sugar levels will rise and the sugar levels reach above 180 mg/100 ml. The extra sugar will spill into the urine causing high levels of sugar in the urine. So to make energy available the fat sources will be used for getting energy as a result of' which ketoacids in the blood and urine will increase.

The onset of ketoacidosis is gradual but in the young diabetics this development is faster. Diabetic coma can develop in 12-24 hours. Many symptoms are similar to hypoglycemia but additional symptoms can appear. These are excessive urination, excessive thirst, increased hunger, drowsiness, unexplained weight loss, slow healing of cuts and wounds, dry itching skin, vaginal itching, abnormal pain and rapid shallow breathing with acetone smell.


Related Discussions:- What will happen without enough insulin

Define single beam and double beam optical path, Define Single Beam and Dou...

Define Single Beam and Double Beam Optical Path? In simpler instruments, a single beam of light passes through the cuvettes and reaches the detector whereas in the double beam

Female reproductive system - graffian follicle, GRAFFIAN FOLLICLE - ...

GRAFFIAN FOLLICLE - It appears as knob or stigma in medulla. It is round, discovered by Graff. It is covered by 2 layers - thecae externa & theca interna. From theca i

What is the structural representation of a carboxyl group, What is the stru...

What is the structural representation of a carboxyl group? Carboxyl groups have a carbon attached to single hydroxyl group by a simple bond and to one oxygen by a double bond.

Define energy and protein requirement in geriatric nutrition, Define Energy...

Define Energy and Protein requirements in geriatric nutrition? Decreased physical activity and changes in body composition and decreased basal metabolic rate affects the ma

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Is geometric isomers have the same connectivity, Geometric isomers: Select ...

Geometric isomers: Select one: a. Have the same molecular weight b. Have the same connectivity c. Have a different configuration about a double bond d. All of the above

Pre-operative nursing management of cardiac surgical patient, PRE-OPERATIVE...

PRE-OPERATIVE NURSING MANAGEMENT OF CARDIAC SURGICAL PATIENTS Cardiac surgical patients generally get investigated thoroughly before getting referred to the surgeons. Many of

Orthopedics, 1. List alternative therapies for musculoskeletal problems. ...

1. List alternative therapies for musculoskeletal problems. 2. What is a xyrospasm? What is the Greek derivative of the word? 3. Name and describe the three types of varus con

Polypeptide chains of hemoglobin, Q. In sickle cell anemia, a hereditary di...

Q. In sickle cell anemia, a hereditary disease, there is replacement of one amino acid by another in one of the four polypeptide chains of hemoglobin. In this case are all of the s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd