Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What will happen without enough insulin?
Without enough insulin two things can happen. Firstly, the cells of the body will be unable to use the glucose in the blood for energy. Secondly, glucose cannot be converted to glycogen in the liver for future use. Thus blood sugar levels will rise and the sugar levels reach above 180 mg/100 ml. The extra sugar will spill into the urine causing high levels of sugar in the urine. So to make energy available the fat sources will be used for getting energy as a result of' which ketoacids in the blood and urine will increase.
The onset of ketoacidosis is gradual but in the young diabetics this development is faster. Diabetic coma can develop in 12-24 hours. Many symptoms are similar to hypoglycemia but additional symptoms can appear. These are excessive urination, excessive thirst, increased hunger, drowsiness, unexplained weight loss, slow healing of cuts and wounds, dry itching skin, vaginal itching, abnormal pain and rapid shallow breathing with acetone smell.
External Respiration: Diffusion of oxygen into blood and carbon dioxide into alveoli (external respiration) is the diffusion of oxygen from air in the alveoli of lungs to bl
Q. Can the heat capacity of water be considered small or large? What is the biological consequence of that characteristic? From Thermology it is acknowledged that the quantity
Explain the Birth in human biology? In humans, birth of the infant occurs about 270 days after conception. The period during which the uterus contracts to expel the newborn
how to classify the plants ?
One characteristic of the DNA molecule is its replication capability. What are the consequences of failures during DNA replication? Ideally a DNA molecule should replicate in a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the main symptoms of the pulmonary and of the intestinal phases of the ascaris infestation? In the pulmonary period the ascaris infestation causes hemoptysis, cough
State about the lengthy administration of test battery The lengthy administration of test battery may be unsuitable for some individuals (such as demented or psychiatric patien
Explain the Assessment of Zn Status? Sensitive indices for assessing zinc status are unknown at present. Static indices, such as zinc concentration in plasma, blood cells and h
What are the main biological functions in which chlorine ions participate? Like sodium cations, chlorine anions actively participate in the regulation of the osmolarity of tiss
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd