What is visual accommodation, Biology

Assignment Help:

What is visual accommodation?

Visual accommodation is the phenomenon of varying the curvature of the crystalline lens to make possible the variation of its refractivity to adjust the images of objects precisely onto the retina. The visual accommodation is accomplished by the action of the ciliary muscles.

The nitid vision depends on the visual accommodation as, if the images are not projected onto the retina but in front or behind it, they will appear blurred. The closer an object is more the ciliary muscles must compress the crystalline lens (enhancing its curvature); the more distant an object is more the ciliary muscles must relax.

 


Related Discussions:- What is visual accommodation

Explain deficiency diseases due to vitamin c, Explain Deficiency diseases d...

Explain Deficiency diseases due to vitamin C? Vitamin C deficiency in human's results in the disease called scurvy, whose symptoms include hemorrhaging (especially in the gums)

What is the nucleolus, What is the nucleolus? The nucleolus is a small ...

What is the nucleolus? The nucleolus is a small and optically dense region in the interior of the cell nucleus. It is made of ribosomic RNA (rRNA) and proteins. Single nucleus

How to recognition of congenital heart disease, How to Recognition of Conge...

How to Recognition of Congenital Heart Disease ? The manifestations of CE-ID are different in a neonate, an infant or a child. It is often easy to recognise the presence of CHD

Altered glucose metabolism - metabolic response to injury, Explain the Alte...

Explain the Altered Glucose Metabolism - Metabolic Response to Injury? Following injury, hypoglycemia commonly occurs and is related to the severity of the stress. In the ebb p

differences between rna and dna , Ribo Nucleic Acid contains OH group at s...

Ribo Nucleic Acid contains OH group at second carbon where as Deoxyribo Nucleic Acid lacks OH group at Second carbon.....DNA is Double standed helix whereas RNA is single stranded

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine balanced diet for celiac disease, Determine Balanced Diet For Cel...

Determine Balanced Diet For Celiac Disease? Energy: initially the children are seen to be malnourished, thus 100-120 Kcal/kg body weight/day with gradual increase to 150 Kcal

Tongue grafting, Tongue grafting Top of the stock is cut diagonally ...

Tongue grafting Top of the stock is cut diagonally and in an upward direction. Scion is cut diagonally in downward direction. A second cut is given from above downwards,

Define the term - cholera, Define the term - Cholera Cholera is caused...

Define the term - Cholera Cholera is caused by the gram negative,  V. cholerae, which is acquired by ingesting food or water contaminated  by faecal material from patients or

Complications of diverticular disease, Q. Complications of diverticular dis...

Q. Complications of diverticular disease? The many complications of the disease include the 'following conditions: • A perforation (hole) in the intestine leading to perito

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd