What is vernalisation, Biology

Assignment Help:

What is vernalisation?

How is the process of vernalisation benefits to plants?

 


Related Discussions:- What is vernalisation

Explain haploid cells and triploid cells, Q. Can mitosis occur in haploid (...

Q. Can mitosis occur in haploid (n) cells and in triploid cells? The mitotic cell division can occur in haploid (n) cells, diploid (2n) cells, triploid (3n) cells, and so on. M

What are the common congenital heart disease, Q. What are the Common congen...

Q. What are the Common congenital heart disease? Fossa Ovalis ASD Commonest defect is fossa ovalis ASD. It can be closed by devices. ASD should be sized in various views

Define interactions between volatile substances and proteins, Define Intera...

Define Interactions between Volatile Substances and Proteins? Flavour binding may involve adsorption at the surface of food or penetration to the food interiority by diffusion

How do dioxins enter the human diet, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

History of the cell, HISTORY OF THE CELL Term "Cytology" was given b...

HISTORY OF THE CELL Term "Cytology" was given by Hertwig , he also wrote a book on " Cell and Tissue ". Father of cytology = Robert Hooke. Father of Modern cytology

What is patient''s plasma osmolarity after the infusion, Tina administered ...

Tina administered 1 liter of sterile distilled water IV to a patient. Predict the direction (increase, decrease, no change) you would expect Tina's infusion to have produced in the

Heat energy is liberated during respiration, Some amount of energy is gener...

Some amount of energy is generatred from the oxidation of food materials is released as heat. This can be proved by germinating seeds. Aim: To show that heat is liberated during re

Botany, how can i earn money by submitting assignments?

how can i earn money by submitting assignments?

Explain the bio availability of vitamin a, Explain the Bio availability of ...

Explain the Bio availability of Vitamin A? By now it is clear that vitamin A is supplied in two forms. One form is retinol, from animal foods such as liver, fatty fish, eggs, a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd