Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is vernalisation?
How is the process of vernalisation benefits to plants?
Q. Can mitosis occur in haploid (n) cells and in triploid cells? The mitotic cell division can occur in haploid (n) cells, diploid (2n) cells, triploid (3n) cells, and so on. M
Q. What are the Common congenital heart disease? Fossa Ovalis ASD Commonest defect is fossa ovalis ASD. It can be closed by devices. ASD should be sized in various views
Define Interactions between Volatile Substances and Proteins? Flavour binding may involve adsorption at the surface of food or penetration to the food interiority by diffusion
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
HISTORY OF THE CELL Term "Cytology" was given by Hertwig , he also wrote a book on " Cell and Tissue ". Father of cytology = Robert Hooke. Father of Modern cytology
Tina administered 1 liter of sterile distilled water IV to a patient. Predict the direction (increase, decrease, no change) you would expect Tina's infusion to have produced in the
Some amount of energy is generatred from the oxidation of food materials is released as heat. This can be proved by germinating seeds. Aim: To show that heat is liberated during re
how can i earn money by submitting assignments?
Explain the Bio availability of Vitamin A? By now it is clear that vitamin A is supplied in two forms. One form is retinol, from animal foods such as liver, fatty fish, eggs, a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd