What is vena cava, Biology

Assignment Help:

What is vena cava? Which type of blood circulates within the vena cava?

The vena cava are either of two large veins that debouch into the right atrium. The superior vena cava drains all blood that comes from the head, the superior limbs, the neck and the superior portion of the trunk. The inferior vena cava carries blood drained from the inferior portion of the trunk and the inferior limbs.

Venous blood circulates within the vena cava.

 


Related Discussions:- What is vena cava

Valuation of biodiversity, Q. Show the Valuation of Biodiversity? Serio...

Q. Show the Valuation of Biodiversity? Serious research in this field has only been recently initiated and the methodologies for valuation are still evolving. Important valuat

How many grams of kanamycine would dissolve, To make a 40 mg/mL solution of...

To make a 40 mg/mL solution of kanamycin (MW 582.6) how many grams of kanamycine would you dissolve in 500 mL of water?

Diastolic heart failure, Unfortunately, unlike heart failure due to systoli...

Unfortunately, unlike heart failure due to systolic dysfunction, diastolic heart failure has been studied in few clinical trials, so there is little evidence to guide the care of p

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Agro industrial-animal wastes, Animal wastes Large quantities of anima...

Animal wastes Large quantities of animal wastes are available in the country but generally they are low in nutrient content with poor feeding value to the animals. However, po

Waxes, WAXES These are monoglyceride compounds. They are chemical...

WAXES These are monoglyceride compounds. They are chemically inert (due to absence of double bonds) and insoluble in water. On heating they become soft and pliable

Determine what is the Cell Cycle, The cell cycle undergoes a sequence of ch...

The cell cycle undergoes a sequence of changes which involve a period of growth replication of DNA, Followed by cell division. This sequence of changes is called cell cycle.

Define precipitation or solubility of proteins, Define Precipitation or Sol...

Define Precipitation or Solubility of Proteins? Most of the functional properties are dependent on the degree to which the proteins are soluble. The solubility behaviour provid

Galvanotaxis - modes of cell movement, Galvanotaxis - Modes of Cell Movemen...

Galvanotaxis - Modes of Cell Movement Galvanotaxis considers to the movement of cells in response to a potential variation between cells. It is suggested that there are voltag

Explain the decolourizing agent - ziehl-neelsen method, Explain the Decolou...

Explain the Decolourizing Agent - Ziehl-Neelsen Method? Acid alcohol - a mixture of 95% ethanol and 3% HCI - is used for decolourization. Before decolourization, smear is allow

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd