Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is vena cava? Which type of blood circulates within the vena cava?
The vena cava are either of two large veins that debouch into the right atrium. The superior vena cava drains all blood that comes from the head, the superior limbs, the neck and the superior portion of the trunk. The inferior vena cava carries blood drained from the inferior portion of the trunk and the inferior limbs.
Venous blood circulates within the vena cava.
Which of the following is a true statement regarding the process of RNA editing? A. RNA editing alters the sequence of the mRNA message thereby permitting for an enhance in pro
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define observation or inference for barfoed test? 1. Reddish brown precipitate is seen on the sides and bottom of the tube. The precipitate of the sides and bottom indicates th
Are protozoans presenting contractile, or pulsatile, vacuoles easily found in fresh or in salt water? Fresh water is the less concentrated of solutes than sea water and it (fre
Define B-Complex Vitamins required for elderly? B-Complex Vitamins: Various B complex vitamins especially B folic acid, B 6 , and riboflavin are found to affect favourably t
What are the uses of microorganisms
signals for parturition is originate from
How do placental mammals reproduce? Placental mammals reproduce sexually, they have internal fecundation and they are viviparous, i.e., their embryo creates within the mother's
explain the lock and key theory
Q. Explain Thalamus and Hypothalamus ? Thalamus and Hypothalamus: The thalamus is situated in the forebrain at the uppermost part of the diencephalon (posterior part of the for
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd