What is total amount of both reactants and products decrease, Biology

Assignment Help:

In Chemical Reactions that have a large negative /\Go'

a- the total amount of both reactants and products decreases

b- the products are less stable than the reactants

c- there is a large excess of products to reactants when the reaction reaches equilibrium

d- the activation energy is always very low

Related Discussions:- What is total amount of both reactants and products decrease

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Glycogen synthesis, To synthesize glycogen two enzymes are needed: 1. U...

To synthesize glycogen two enzymes are needed: 1. UDP-glucose pyrophosphorylase catalyzes the synthesis of UDP-glucose from UTP and glucose 1-phosphate: The py

Conditions essential for the germination of seeds, To study the conditions ...

To study the conditions essential for the germination of seeds:- In the diagram below a having seeds on cotton wool with air, warmth, but no water; b has water, warmth, but no

Define role of food industry, Define Role of Food Industry? Publication...

Define Role of Food Industry? Publications of major trade associations; industry standards; structure of the food industry; international food corporations; information on alli

Totipotency, what is totipotency?

what is totipotency?

Digestive system - buccal cavity, BUCCAL CAVITY - Situated between u...

BUCCAL CAVITY - Situated between upper & lower jaw. It is lined by stratified squamous epithelium. Separated from nasal chamber by palate. Palate forms roof of buccal cav

Organization in non-reduced embryo sacs , Organization in non-reduced embry...

Organization in non-reduced embryo sacs The fate of a nucleus in the embryo sac depends upon its position. Many irregularities in the disposition of nuclei in the early polar

Functions of albumin and myosin, Q. What are respectively some remarkable f...

Q. What are respectively some remarkable functions of albumin, myosin, CD 4 , keratin, immunoglobulin, reverse transcriptase, hemoglobin and insulin? Myosin is a protein that w

Explain cell surface membrane, Diagram of a cell surface membrane. ...

Diagram of a cell surface membrane. State the width of a cell surface membrane. (i) On which side of the membrane, shown in Figure, X or Y, is the cytoplasm of the cell?

Dot blot, Dot blot is the technique for measuring the amount of one pertic...

Dot blot is the technique for measuring the amount of one perticular DNA or RNA in the highly complex mixture. The samples are spotted onto the hybridization membrane (like nitroc

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages