Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In Chemical Reactions that have a large negative /\Go'
a- the total amount of both reactants and products decreases
b- the products are less stable than the reactants
c- there is a large excess of products to reactants when the reaction reaches equilibrium
d- the activation energy is always very low
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
To synthesize glycogen two enzymes are needed: 1. UDP-glucose pyrophosphorylase catalyzes the synthesis of UDP-glucose from UTP and glucose 1-phosphate: The py
To study the conditions essential for the germination of seeds:- In the diagram below a having seeds on cotton wool with air, warmth, but no water; b has water, warmth, but no
Define Role of Food Industry? Publications of major trade associations; industry standards; structure of the food industry; international food corporations; information on alli
what is totipotency?
BUCCAL CAVITY - Situated between upper & lower jaw. It is lined by stratified squamous epithelium. Separated from nasal chamber by palate. Palate forms roof of buccal cav
Organization in non-reduced embryo sacs The fate of a nucleus in the embryo sac depends upon its position. Many irregularities in the disposition of nuclei in the early polar
Q. What are respectively some remarkable functions of albumin, myosin, CD 4 , keratin, immunoglobulin, reverse transcriptase, hemoglobin and insulin? Myosin is a protein that w
Diagram of a cell surface membrane. State the width of a cell surface membrane. (i) On which side of the membrane, shown in Figure, X or Y, is the cytoplasm of the cell?
Dot blot is the technique for measuring the amount of one perticular DNA or RNA in the highly complex mixture. The samples are spotted onto the hybridization membrane (like nitroc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd