What is the virus that causes flu, Biology

Assignment Help:

What is the virus that causes flu? Why doesn't the body create permanent immunity against that virus? How does the vaccine against flu work?

Flu is a disease caused by the influenza virus, a highly mutant DNA virus. Because of the high mutation rate of the virus, that forms many dissimilar strains, flu always presents epidemic features in affected populations and people may have some flu episodes during life (the immune response made from previous infections is not efficient in future infections).

The vaccine against flu is a vaccine made of attenuated virus of three dissimilar strains. Each year the WHO (World Health Organization) researches and determines which are the strains that should compose the vaccine. This is a method to face the high mutation rate of the virus.

 


Related Discussions:- What is the virus that causes flu

Which of the groups is not ionizable, Which of the following groups is NOT ...

Which of the following groups is NOT ionizable? Select one: a. Guanidinium b. Imidazole c. Phosphoryl d. Amine e. Aldehyde

Explain carboxymethyl cellulose, Carboxymethyl Cellulose (CMC) CMC is a...

Carboxymethyl Cellulose (CMC) CMC is a linear, long-chain, water-soluble, anionic modified polysaccharide. It is a derivative of cellulose formed by its reaction with alkali an

Gastro epiploic artery ge-other arterial conduits, Gastro Epiploic Arte...

Gastro Epiploic Artery (GE) :  Gastro epiploic artery is a less popular arterial conduit now. The midline chest incision is extended to the umbilicus and the right ga

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Biologyical problem, Ask question #Minimum 100 hhejejhjehjwords accepted#

Ask question #Minimum 100 hhejejhjehjwords accepted#

What are the uses of national parks, Q. What are the uses of National parks...

Q. What are the uses of National parks ? National Park is an area dedicated to conserve environment, natural and historical objects and to conserve the wild life therein. Natio

Describe in brief about failing implant, Describe in brief about failing im...

Describe in brief about failing implant The failing implant may show evidence of pocketing, bleeding upon probing, purulence, and indicates the bone loss patterns are progressi

Explain restaurant deep fat frying evaluation, Restaurant deep fat frying e...

Restaurant deep fat frying evaluation A number of factors are studied when evaluating frying oils. During deep fat frying, the fat is exposed continuously to elevated temperat

What is the difference between brain and cerebrum, What is the difference b...

What is the difference between brain and cerebrum? What are the main parts of these structures? The concept of brain, or encephalon, comprehends the cerebrum (mostly referred t

What is the role of Naupliar eye, What is the role of Naupliar eye? The...

What is the role of Naupliar eye? The unique eye found in larval stage of the crustacean life cycle. This single compound eye is located medially, and with exception of copepod

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd