Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the virus that causes flu? Why doesn't the body create permanent immunity against that virus? How does the vaccine against flu work?
Flu is a disease caused by the influenza virus, a highly mutant DNA virus. Because of the high mutation rate of the virus, that forms many dissimilar strains, flu always presents epidemic features in affected populations and people may have some flu episodes during life (the immune response made from previous infections is not efficient in future infections).
The vaccine against flu is a vaccine made of attenuated virus of three dissimilar strains. Each year the WHO (World Health Organization) researches and determines which are the strains that should compose the vaccine. This is a method to face the high mutation rate of the virus.
Which of the following groups is NOT ionizable? Select one: a. Guanidinium b. Imidazole c. Phosphoryl d. Amine e. Aldehyde
Carboxymethyl Cellulose (CMC) CMC is a linear, long-chain, water-soluble, anionic modified polysaccharide. It is a derivative of cellulose formed by its reaction with alkali an
Gastro Epiploic Artery (GE) : Gastro epiploic artery is a less popular arterial conduit now. The midline chest incision is extended to the umbilicus and the right ga
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ask question #Minimum 100 hhejejhjehjwords accepted#
Q. What are the uses of National parks ? National Park is an area dedicated to conserve environment, natural and historical objects and to conserve the wild life therein. Natio
Describe in brief about failing implant The failing implant may show evidence of pocketing, bleeding upon probing, purulence, and indicates the bone loss patterns are progressi
Restaurant deep fat frying evaluation A number of factors are studied when evaluating frying oils. During deep fat frying, the fat is exposed continuously to elevated temperat
What is the difference between brain and cerebrum? What are the main parts of these structures? The concept of brain, or encephalon, comprehends the cerebrum (mostly referred t
What is the role of Naupliar eye? The unique eye found in larval stage of the crustacean life cycle. This single compound eye is located medially, and with exception of copepod
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd