Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the Speech Perception Test
The subject is asked to listen to a series of 60 sounds, each of which consists of a double e digraph with varying prefixes and suffixes. The test is given in a four-alternative multiple-choice format, the task being to underline on an answer sheet the sound heard, the score is the number of errors.
A person with a cough takes a patent cough syrup. In three days, the cough is better. Does this mean that the syrup has cured the cough? Justify your answer. There is insuffic
Why, even though they have an open circulatory system, can flying insects like flies beat their wings with great speed? In insects the circulatory system is open but this syste
From which part of the teeth is it particularly important to remove plaque. It is most significant to remove plaque from among the teeth and from the region where the gum cover
Explain the chemical properties of milk Autoclaving milk, wherein temperature of around 121 o C is achieved, causes browning. The brown colour is due to the heat effecting an i
Osmoregulatory Animal An osmoregulatory animal is generally in an osmotic steady state even though there may be hourly and daily variations in osmotic balance. The concentrati
Post-parturient haemoglobinuria (pph) in cattle and buffaloes The post-parturient haemoglobinuria (PPH) is an acute disease of high yielding buffaloes and cows. The disease oc
Total Fertility Rate Total fertility rate (TFR) is the total number of children a women can be expected to bear in a given population if birth rates are constant for at least
Transposable elements are able to move around the genome by precise or imprecise excision events. What is meant by imprecise excision? A. Imprecise excision refers to a transpo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Kingdom Animalia Multicellular, heterotrophic, eukaryotes, tissues are specialised and most of them have organs, mostly highly responsive. Only gametes are haploid, fertilisation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd