Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the role of heart in human body?
The heart is the main pump that circulates the blood and fluid within the body. The heart, beats at 72 times per minute, and pumps about 5.5 liters of blood per minute in the average adult. The heart of a young athlete can reach 180 or more beats per minute and can pump over 17 liters of blood per minute.
The human heart has four chambers. The upper chambers receive blood and are called atria (singular atrium; sometimes also called auricles). The lower chambers, or ventricles, pump blood to the lungs and throughout the body. Flaps of tissue called atrioventricular valves prevent blood from flowing back into the atria when the ventricles contract. The atrioventricular or a-v valve, on the right side of the body, leading from the right atrium to the right ventricle, is the tricuspid valve. The one leading from the left atrium to the left ventricle is the bicuspid valve, also called the mitral valve.
The heart consists of two separate pumping systems, the right side for the pulmonary circulation to the lungs, and the left side for systemic circulation to the rest of the body. The heart muscle tissues are supplied with oxygen and nutrients by their own circulatory system. Two arteries, called the coronary arteries, branch from the aorta, the main artery of the heart, just beyond the semilunar valves. These break up into arterioles and capillaries that supply the heart muscles and heart valves. Blood from the capillaries is collected in veins leading into a large vein called the coronary sinus, which directly enters the right atrium.
Q. How many cells are made after meiosis II and meiosis I? After meiosis II four cells are created, After Meiosis I two cells with already separated homologous are created
Pulmonary stenosis is a relatively common congenital heart defect. Usually these children with mild to moderate pulmonary stenosis survive into childhood. Since bicuspid pulmonary
where does kreb cycle takes place
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q What is the kind of digestive system of echinoderms? Echinoderms present a complete digestive system with anus and mouth. Q. Do sea urchins have teeth? Sea urchins ha
Define the types of Ketogenic Diets? The ketogenic diet is initiated after an initial period of Pasting for 24-72 hours, till ketosis is established. There are two types of ket
Q. What is the relationship between environmental resistance and the population growth according to the biotic potential curve and the real population growth curve? The differe
Explain Tetralogy of fallot repair and Transposition of arteries? Tetralogy of Fallot Repair: This involves RV outflow resection, closure of the VSD and enlargement of the RV
What are the blood types of the ABO blood system? The type A, the type B, the type AB and the type O are the blood types of the ABO blood system..
Organic Molecules Some organic molecules in life are Carbohydrates and Lipids à C, H and O Proteins à C, H, O, N & sometimes S Nucleic acids à C, H, O, N & P
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd