What is the microflake - t dehydration, Biology

Assignment Help:

What is the Microflake - T Dehydration?

This technique involves the drying of a continuous sheet of foam 20 mm thick on a continuous stainless steel belt. The later is heated from below by steam and above by a high velocity air stream and drying times are reported to be about one tenth of the standard process.

 


Related Discussions:- What is the microflake - t dehydration

The digestive processes, Alimentary tract The alimentary tract and the ...

Alimentary tract The alimentary tract and the secretary organs associated with it are involved in the process of digestion. The sequence of events includes ingestion of food, d

Zoology, characteristics of class mamalias

characteristics of class mamalias

Type of fecundation that occur in arthropods, Q. What are the kinds of fecu...

Q. What are the kinds of fecundation that occur in arthropods? What is the predominant kind? In arthropods there are species having exterior fecundation and other species havin

Define supplementary feeding to control under nutrition, Define Supplementa...

Define Supplementary feeding to control under nutrition? Supplementary feeding has remained an important component to control under nutrition. Considering the dietary inadequac

What is saliva, What is Saliva Saliva   is  the colourless  viscous  f...

What is Saliva Saliva   is  the colourless  viscous  fluid.  It  helps  in  swallowing the  food  by lubricating the food and the neutral pH of saliva prevents the decalcifica

Tissue culture, Note on production of haploid by tissue culture.

Note on production of haploid by tissue culture.

Illustrate the types of Bone Remodeling, Illustrate the types of Bone Remod...

Illustrate the types of Bone Remodeling Bone remodeling occurs on existing bone surfaces. However, unlike modeling, remodeling cannot cause large changes in bone structure at a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define role of nutrients in controlling gene expression, Define Role of Nut...

Define Role of Nutrients in Controlling Gene Expression? The role of several nutrients in controlling gene expression, as mentioned earlier, is in infancy, but with advancing b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd