Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the meaning of Food Exchanges
Food exchanges mean grouping of foods in which the specified amount of all the food provides approximately equal amounts of carbohydrate, protein and fat. Thus, with the concept of food exchanges, a doctor or dietician make the food exchange list to give flexibility in diet plan.
Foods can be "exchanged" with other food items in a category and meet the nutrition requirements. Exchanges make it easier to follow a prescribed diet.
Explain about the Fermentation - methods of food processing? In contrast to other preservation methods, multiplication of microorganisms and their metabolic activities are enco
CATEGORIES OF DRUGS - 1 . Anaesthetic - Produces anaesthesia 2. Analgesic - Reliev
How does parafunctional habits lead to implant failure Parafunctional habits like bruxism and clenching create mechanical and biological problems due to overloading and is cons
Salient Features of pulmonary tuberculosis The salient features tuberculosis include: Wasting of tissues Exhaustion Cough Expectoration, and Fever The acute p
By-Products from Sugar Industry India is one of the important sugarcane (Saccharum officinarum) growing countries of the world. Five main by-products are available from the su
Segmentation in Regenerating Annelids Several worms as they grow continue to add new segments at the posterior end. In these, segmentation takes place in a growth zone located
Find the initial osmotic pressure at room temperature of a cell if the only ions present are CaCl2 on either side of the membrane. Assume the concentrastions for K+ and Cl- from Ta
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Compare and contrast replication, transcription, and translation based on the following criteria. Criteria Replication Transcription
Why does bark often die and break naturally? The bark is the mature periderm of the stem, branches and roots. It dies and breaks when these structures grow and thus the perider
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd