What is the meaning of food exchanges, Biology

Assignment Help:

What is the meaning of Food Exchanges

Food exchanges mean grouping of foods in which the specified amount of all the food provides approximately equal amounts of carbohydrate, protein and fat. Thus, with the concept of food exchanges, a doctor or dietician make the food exchange list to give flexibility in diet plan.

Foods can be "exchanged" with other food items in a category and meet the nutrition requirements. Exchanges make it easier to follow a prescribed diet.

 


Related Discussions:- What is the meaning of food exchanges

Explain about the fermentation - methods of food processing, Explain about ...

Explain about the Fermentation - methods of food processing? In contrast to other preservation methods, multiplication of microorganisms and their metabolic activities are enco

Categories of drugs, CATEGORIES OF DRUGS - 1 . ...

CATEGORIES OF DRUGS - 1 . Anaesthetic - Produces anaesthesia 2. Analgesic - Reliev

How does parafunctional habits lead to implant failure, How does parafuncti...

How does parafunctional habits lead to implant failure Parafunctional habits like bruxism and clenching create mechanical and biological problems due to overloading and is cons

Explain salient features of pulmonary tuberculosis, Salient Features of pul...

Salient Features of pulmonary tuberculosis The salient features tuberculosis include: Wasting of tissues Exhaustion Cough Expectoration, and Fever The acute p

Agro industrial-by-products from sugar industry, By-Products from Sugar Ind...

By-Products from Sugar Industry India is one of the important sugarcane (Saccharum officinarum) growing countries of the world. Five main by-products are available from the su

Segmentation in regenerating annelids, Segmentation in Regenerating Annelid...

Segmentation in Regenerating Annelids Several worms as they grow continue to add new segments at the posterior end. In these, segmentation takes place in a growth zone located

Find initial osmotic pressure on room temperature of a cell, Find the initi...

Find the initial osmotic pressure at room temperature of a cell if the only ions present are CaCl2 on either side of the membrane. Assume the concentrastions for K+ and Cl- from Ta

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Compare & contrast replication, Compare and contrast replication, transcrip...

Compare and contrast replication, transcription, and translation based on the following criteria.   Criteria Replication Transcription

Why does bark often die and break naturally, Why does bark often die and br...

Why does bark often die and break naturally? The bark is the mature periderm of the stem, branches and roots. It dies and breaks when these structures grow and thus the perider

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd