Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the function of the vitellus in the vertebrate egg? How are these eggs classified according to the amount of vitellus within them?
Vitellus (yolk) is the nutritive material that accumulates in the cytoplasm of the egg (zygote) with the function of nourishing the embryo According to the amount of vitellus in them, the vertebrate eggs are classified as centrolecithal, oligolecithal (little yolk), or heterolecithal (more yolk diffusely distributed) and telolecithal (more yolk concentrated in one end of the egg).
ROLE OF NaCl - It forms .9% of blood of mammal. It forms .7% of blood of frog. Bicarbonates of Na+ act as buffer for pH constancy. Involved in active transport of gluc
What is the relationship of hydrogen ion concentration in tomato juice relative to lemon juice and to pure water? Be as quantitative as you can (i.e., use numbers to describe the m
Explain the Protein Deficiency? One of the most common nutritional disorders in the world today is the deficiency of protein. Both adults and children are affected, as the popu
How can denaturizing be classified regarding its reversibility? Ans) Protein denaturizing can be a reversible or irreversible process, i.e., it can be possible or impossible to
In 1906, Greenfield described the fabrication and insertion of an endossoeus implant. He for the first time, used a basket shaped, round, hollow implant made of an iridium-platinu
explain excretory system of prawn?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Given four respiratory capacities (a - d) and four jumbled respiratory volumes of a normal human adult: Respiratory Respiratory capacities volumes. 1. Residual vol
what is origin ofspharosome
This valve has the same basic features as of the Tricuspid Valve. It has an anterior and a posterior cusp. The anterior cusp is larger and is attached on the upper right part of t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd