What is the function of the vitellus in the vertebrate egg, Biology

Assignment Help:

Q. What is the function of the vitellus in the vertebrate egg? How are these eggs classified according to the amount of vitellus within them?

Vitellus (yolk) is the nutritive material that accumulates in the cytoplasm of the egg (zygote) with the function of nourishing the embryo According to the amount of vitellus in them, the vertebrate eggs are classified as centrolecithal, oligolecithal (little yolk), or heterolecithal (more yolk diffusely distributed) and telolecithal (more yolk concentrated in one end of the egg).


Related Discussions:- What is the function of the vitellus in the vertebrate egg

Role of nacl in metabolism, ROLE OF NaCl - It forms .9% of blood of ...

ROLE OF NaCl - It forms .9% of blood of mammal. It forms .7% of blood of frog. Bicarbonates of Na+ act as buffer for pH constancy. Involved in active transport of gluc

Consider a ph scale while answering, What is the relationship of hydrogen i...

What is the relationship of hydrogen ion concentration in tomato juice relative to lemon juice and to pure water? Be as quantitative as you can (i.e., use numbers to describe the m

Explain the meaning of protein deficiency, Explain the Protein Deficiency? ...

Explain the Protein Deficiency? One of the most common nutritional disorders in the world today is the deficiency of protein. Both adults and children are affected, as the popu

Denaturizing be classified regarding its reversibility, How can denaturizin...

How can denaturizing be classified regarding its reversibility? Ans) Protein denaturizing can be a reversible or irreversible process, i.e., it can be possible or impossible to

Greenfields hollow implant, In 1906, Greenfield described the fabrication a...

In 1906, Greenfield described the fabrication and insertion of an endossoeus implant. He for the first time, used a basket shaped, round, hollow implant made of an iridium-platinu

Prawn, explain excretory system of prawn?

explain excretory system of prawn?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain two capacities and volumes of respiratory, Given four respiratory c...

Given four respiratory capacities (a - d) and four jumbled respiratory volumes of a normal human adult: Respiratory Respiratory capacities volumes. 1.            Residual vol

Spharosome, what is origin ofspharosome

what is origin ofspharosome

Mitral valve, This valve has the same basic features as  of the Tricuspid V...

This valve has the same basic features as  of the Tricuspid Valve. It has an anterior and a posterior cusp. The anterior cusp is larger and is attached on the upper right part of t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd