What is the difference between amnion and chorion, Biology

Assignment Help:

Q. What is the difference between amnion and chorion?

Amnion is the membrane that covers the embryo and Chorion is the membrane that covers the amnion the allantois and the yolk sac. The space delimited by the amnion and the chorion is called amniotic cavity and it is filled with aminiotic fluid. The amniotic cavity has the functions of avoiding desiccation of the embryo and of protecting it against mechanical shocks.


Related Discussions:- What is the difference between amnion and chorion

What is standard operating procedure manual (sop), Question 1 What is s...

Question 1 What is standard operating procedure manual (SOP)? Do you think it is important to maintain SOPs in all the laboratories? List the advantages of maintaining SOPs in

Safety measures in the administration of drugs, SAFETY MEASURES IN THE ADMI...

SAFETY MEASURES IN THE ADMINISTRATION OF DRUGS It is essential to revise the five "Rights" before administration of medication to the paediatric group. These as you know are:

Evaluate the short tailed hamster''s genotype, You are given a hamster that...

You are given a hamster that has a very short tail (dominant trait) a) Describe a cross that would allow you to determine the short tailed hamster's genotype b) What are the possib

Human diseases caused by virus, Q. What are some human diseases caused by v...

Q. What are some human diseases caused by virus and what are their respective modes of transmission? The major viral diseases transmitted by respiratory secretions (cough, snee

What are the types of chronic gastritis, Q. What are the types of chronic g...

Q. What are the types of chronic gastritis? Gastroscopic observation shows different types of chronic gastritis: 1. Superficial gastritis: gastric mucosa is red, oedematous,

Maintenance in the continuing care cycle, Maintenance in the Continuing Car...

Maintenance in the Continuing Care Cycle Impaired dexterity: Any impairment of dexterity, even if it is temporary, may be detrimental to dental implants because home maintena

What is the typical vegetation of the grasslands, What is the typical veget...

What is the typical vegetation of the grasslands? The Grasslands are mainly formed of herbaceous (nonwoody) vegetation: grass, small trees and bushes.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Animalia, porifera characteractericts

porifera characteractericts

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd