What is subxiphoid short axis sweep, Biology

Assignment Help:

Q. What is Subxiphoid Short Axis Sweep?

To obtain the subxiphoid short axis view transducer should be rotated by 90 degree clockwise, fi-om the previous position so that pointer points inferiorly. Sweep should start from right to left gradually until apex of heart is seen. Atria including its venou$ connections and interatrial septum are visualized in right sided cuts. All type of atrial septa1 defects, right upper and right lower pulmonary veins cauld be seen in this view. Atrial morphology can be decided in this view.

When transducer is rotated further towards left, aortic valve along with proximal ascending aorta, mitral and tricuspid valves are seen. Further rotation of transducer provide view of pulmonary valve and main pulmonary artery. One may decide the location of VSD in this view, sub infundibular muscle bundle and mal-alignment of outlet septum, relationship between semilunar valves and AV valves can be seen in this view by slight rotation of the transducer. Hence these view are important while making the more complex diagnosis. Ventricles can be seen in short axis view (circular LV and crescent shape RV). Muscular VSDs at various plane can be located by this sweep.


Related Discussions:- What is subxiphoid short axis sweep

What is septa, What is Septa Septa are thin bony plates, which divide t...

What is Septa Septa are thin bony plates, which divide the inferior portion of the antrum into sections and may even create separate compartments. A buttress or web formation m

What is the advantage of the occurrence of larval stage, Q. What is the evo...

Q. What is the evolutionary advantage of the occurrence of larval stage and sperm cells in the life cycle of sponges? The sexual reproduction in sponges in addition to contribu

Respiratory care on admission of patient, Respiratory Care on Admission (Fi...

Respiratory Care on Admission (First two hours) Patient is incubated and ventilator-dependent.  Monitor blood gases hourly and take corrective action immediately.

Explain the dna structure in details, Explain the DNA structure in details?...

Explain the DNA structure in details? Structure :  Each DNA molecule is a double stranded polymer, consisting of perhaps thousands or millions of linked nucleotides. The two

Bovine ephemeral fever, B o v i ne ephemeral fever Ephemeral fever ...

B o v i ne ephemeral fever Ephemeral fever is commonly known as 'three-day sickness'. It affects mainly cattle and occasionally sheep in India. Causative agent is a mosquit

What do you mean by ventricular arrhythmias, Q. What do you mean by Ventric...

Q. What do you mean by Ventricular Arrhythmias? Considerable disagreement exists regarding the significance of resting ventricular ectopic beats. In study comparing the coronar

Explain about catheters and guide wires, Q. Explain about Catheters and Gui...

Q. Explain about Catheters and Guide Wires? The commonly used guide wires vary in diameter from 0.012 to 0.052; with 0.035 or 0.038 being the most commonly used sizes. The stan

Tumours of kidney - wilm''s tomour, Tumours of kidney - Wilm's Tomour ...

Tumours of kidney - Wilm's Tomour So  far you have learnt about the disorders in glomerular dysfunctioning, now you will learn about the tumours in kidney the wilm's  tumour.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain nutritional biochemistry, Explain Nutritional Biochemistry A  ...

Explain Nutritional Biochemistry A  good understanding  of the  biochemical  basis  of  nutrient function  and  of  the consequence of nutrient deficiency  or excess  is  impo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd