Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is Subxiphoid Short Axis Sweep?
To obtain the subxiphoid short axis view transducer should be rotated by 90 degree clockwise, fi-om the previous position so that pointer points inferiorly. Sweep should start from right to left gradually until apex of heart is seen. Atria including its venou$ connections and interatrial septum are visualized in right sided cuts. All type of atrial septa1 defects, right upper and right lower pulmonary veins cauld be seen in this view. Atrial morphology can be decided in this view.
When transducer is rotated further towards left, aortic valve along with proximal ascending aorta, mitral and tricuspid valves are seen. Further rotation of transducer provide view of pulmonary valve and main pulmonary artery. One may decide the location of VSD in this view, sub infundibular muscle bundle and mal-alignment of outlet septum, relationship between semilunar valves and AV valves can be seen in this view by slight rotation of the transducer. Hence these view are important while making the more complex diagnosis. Ventricles can be seen in short axis view (circular LV and crescent shape RV). Muscular VSDs at various plane can be located by this sweep.
What is Septa Septa are thin bony plates, which divide the inferior portion of the antrum into sections and may even create separate compartments. A buttress or web formation m
Q. What is the evolutionary advantage of the occurrence of larval stage and sperm cells in the life cycle of sponges? The sexual reproduction in sponges in addition to contribu
Respiratory Care on Admission (First two hours) Patient is incubated and ventilator-dependent. Monitor blood gases hourly and take corrective action immediately.
Explain the DNA structure in details? Structure : Each DNA molecule is a double stranded polymer, consisting of perhaps thousands or millions of linked nucleotides. The two
B o v i ne ephemeral fever Ephemeral fever is commonly known as 'three-day sickness'. It affects mainly cattle and occasionally sheep in India. Causative agent is a mosquit
Q. What do you mean by Ventricular Arrhythmias? Considerable disagreement exists regarding the significance of resting ventricular ectopic beats. In study comparing the coronar
Q. Explain about Catheters and Guide Wires? The commonly used guide wires vary in diameter from 0.012 to 0.052; with 0.035 or 0.038 being the most commonly used sizes. The stan
Tumours of kidney - Wilm's Tomour So far you have learnt about the disorders in glomerular dysfunctioning, now you will learn about the tumours in kidney the wilm's tumour.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Nutritional Biochemistry A good understanding of the biochemical basis of nutrient function and of the consequence of nutrient deficiency or excess is impo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd