Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is S shaped incision?
The S - shaped incision is indicated where a papilla needs to be developed and was first described by Palacci. This type of incision is essentially designed to create a small pedicle flap, which is repositioned into the interdental area.For multiple implants placed unilaterally the pedicel flaps are designed to the position the pedicle on the mesial aspect of the implant. The height of the ridge, the interdental space and thickness of the tissue influence the width of the pedicle. After attachment of the abutment the S-shaped incision started on its distal aspect. The clinician should be able to visualize the final position of the pedicle flap on the mesial aspect of the abutment. The first part of the incision is full thickness and the second part is a split - thickness incision of the periosteum, carried out sub-epithelially. This provides mobility for the pedicle flap without creating a cleft within the marginal epithelium. The first pedicle should be positioned within.
Estimate Daily energy requirement and safe protein intake? The estimated mean daily per capita energy requirement of 2070 Kcal rounded up to 2100 Kcal is based on WHO technica
Residual Volume - Respiration Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Q. What are the destinations of the organic material fabricated by the producers? The Part of the organic material synthesized by the producers is consumed as energy source for
Coarse fish reach or lowland course zone This zone corresponds to the lower course of the river. Here the river is deep and slow moving. Its sluggish flow results in the depos
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
in a school laboratory, what is usually regarded as evidence that photosynthesis has occurred in plants
INTRODUCTIO N - Endocrinolog y - Study of endocrine glands, hormones and their effects. Thomas Addison - Father of endocrinology. Described hormonal disease in 1855 kn
Hemerythrins - Respiratory Pigments The Hemerythrins are rather rare. They take place in some animals belonging to the minor phyla like the sipunculid worms, some brachiopods,
Define Miscibility in binary liquid systems? When two different pure liquids are unable to mix in all proportions, they are said to be partially miscible. When these liquids ar
Describe the factors that affect cardiac output in a female athlete who is speed skating toward the finish line in an Olympic race
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd