Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is Rounded ST Depression?
A rounded ST-segment depression pattern in the CM5 lead, as well as in the other leads, is common and is often associated with ischaemia. This pattern is somewhat difficult to evaluate if the duration of the ST-segment sagging is very short, but it usually reflects ventricular dysfunction. This pattern is associated with slightly increased incidence of subsequent coronary events. Patients with a rounded pattern had a 5.8 per cent per year incidence of coronary events, compared with 8.3 per cent per year for those with a horizontal pattern.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. False Positive ST Changes? 1) The slope of the PQ-segment can help predict the magnitude of the influence of P-wave depolarization and thus help predict which patient wou
What are the main characteristics of the bryophytes? Bryophytes are nonvascular plants, i.e., they do not have conductive tissues and they perform transport of water and nutrie
Define Carbohydrate metabolism - Ageing? Glucose tolerance may be impaired to some extent. Usually, the fasting blood sugar is normal. The absorption of carbohydrate is not im
Q. Requirements of Glutamine in diverticular disease? Glutamine: Wile specific nutrients that may have an impact on diverticula disease have not been studied as thoroughly as t
An ecosystem is a self sufficient interacting system in the biosphere. Eg. forest, desert, pond etc. almost, all the ecosystem have more or less similar fundamental plan for their
Define the Fehling's Soxhlet method (Lane-Eynon method)? This is a titrimetric method that is commonly used in food laboratories to estimate percentage of reducing sugars and t
DEMOGRAPHIC CYCLE - 1 . First stage - B high - D high = 0 2 . Second stage - B high - D lo w = G more eg.
How life exist in earth?
Soybean protein used as stabilized dispersions Soybean protein concentrates have been used as stabilized dispersions in milk-like beverages and simulated dairy products, such a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd