What is risk factor interaction, Biology

Assignment Help:

What is risk factor interaction ?

Coronary artery disease, as has been explained, is a multifactorial disease with diverse risk factors coming together and interacting to produce the pathological changes. The presence of a number of risk factors in a single individual increases the risk many times. Studies such as the Framingham and the MRFIT have clearly shown that the coexistence of multiple risk factors confers a magnified risk which is multiplicative rather than additive. It means that the various risk factors work synergistically to increase the coronary risk and mortality in an exponential manner. A smoker with modest elevations of cholesterol and blood pressure is at greater risk of coronary death than a non-smoker with severe Hypertension or marked hypercholesterolemia. A single risk factor is not sufficiently sensitive to identify all individuals at high risk of coronary artery disease. The bulk of CAD occur in individuals with only moderate elevations of a number of risk factors rather than in those who lie at the upper end of a single risk factor.

1274_Multiplicative effect of risk factors.png

Figure: Multiplicative effect of risk factors

The above picture gives us an idea about the multiplicative effect of various risk factors. The estimated 10 yeas coronary risk show11 here is based on six risk factors - blood pressure, total cholesterol ( TC), HDL cholesterol, diabetes, smoking and presence of ventricular enlargement. As can be seen, the 10 year risk in those without any of the risk factors is less than 10 per cent. II increases to 20 percent when the systematic BP rises to 160 mm Hg and TC becomes 260 mg/dl. The risk increases further to 30 per cent in presence of additional risk factors like diabetes and low HDL cholesterol. Cigarette smoking increases the risk further to 40 per cent whereas ill presence of cardiac enlargement rises steeply to about 60 per cent. This is an important principle Lo remember for preventive measures, because the benefit obtained by improving all the risk factors together, even marginally, is definitely larger than that of strictly controlling a single factor and not addressing the other ones. The demonstration of such multiplicative risk has given rise to the concept of "comprehensive Cardio-vascular risk" or "total risk", estimating the individual's overall risk of developing Cardio-vascular disease resulting front the consortium of factors. This is particularly relevant in the Indian context because of the clustering of risk factors among ethnic Indians.


Related Discussions:- What is risk factor interaction

Define placental secretion of oestrogens during pregnancy, Define Placental...

Define Placental secretion of oestrogens During pregnancy? Placental secretion of oestrogens increase with progression of pregnancy. Oestrogens perform many functions. They sti

Symptoms of mitral regurgitation, Q. Symptoms of mitral regurgitation? ...

Q. Symptoms of mitral regurgitation? Symptoms depend upon underlying etiology of mitral regurgitation. Patients with mild mitral regurgitation and most of those with even sever

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Food and diet, state one benefit of including vegetable fibre in the diet

state one benefit of including vegetable fibre in the diet

What are the roles of atp and nadph, Q. What are the roles of ATP and NADPH...

Q. What are the roles of ATP and NADPH in the chemical stage of photosynthesis? NADPH acts as reductant of carbon dioxide it delivers highly energetic hydrogen to precursor mol

U, uses of conductometry in biological experiments

uses of conductometry in biological experiments

Explain gum tragacanth, Gum Tragacanth  Gum tragacanth, the exudation o...

Gum Tragacanth  Gum tragacanth, the exudation of Astragalus species, is defined as the "dried gummy exudate" obtained from Astragalus gummifer Labillardiere. Gum tragacanth is

What are the temporal factors of abnormality, What are the Temporal Factors...

What are the Temporal Factors of Abnormality Given the on going schedule of postnatal neurodevelopment, the age of the child at the time of exposure and the behaviour can have

Locomotion in echinodermata, Locomotion in Echinodermata Locomotion i...

Locomotion in Echinodermata Locomotion in echinoderms is accomplished through a unique canalicular system which is termed as the water-vascular system. This system is charact

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd