Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Resective therapy
Is used to reduce pockets, correct negative osseous architecture and rough implant surfaces and increase the area of keratinized gingival if needed.
Apically positioned flaps and osseous resective therapy is used to correct the horizontal bone loss and moderate vertical bone loss (<3mm) and to reduce the overall pocket depth. Let us discuss the surgical procedure now. A full thickness flap is raised to access the surgical area. Degranualution of the surgical defect is done while taking care that the metallic instrument does not contact the implant surface. Implant surface is now detoxified and prepared. . Then Surface Polishing or Implantoloplasty is carried out. It is done to arrest the progression of the disease and achieve a maintainable site for the patient. For this purpose, all implant surfaces that are smooth and clean coronal to the bone level are preferred. Therefore, surfaces with threads or roughened topography such as HA are indicated for alterations with high-speed diamond burs and polishers to produce a smooth continuous surface. Copious irrigation for cooling purposes is used while the implant topography is being modified.
It is very vital to understand that Implantoplasty is done only during respective surgery and not regenerative surgery. This is done as metal particles could interfere with the regeneration of bone tissue. Peri-implant bone defects with predominantly horizontal or one wall topographies can be treated resulting in healthy shallow pockets post surgery.
Briefly explain about the Sit-ups Test? To measure muscular endurance, bent knee sit-ups can be done. Sit-ups begin with the subject lying flat on their backs with their knees
State the term - Viral Infections A virus is an encapsulated aggregate of nucleic acid that may be made of either DNA or RNA. Some viruses, such as those causing poliomyelitis
what is the role of cholesterol in membrane fluidity?
Define Conditions associated with increased need for Vitamin A? Conditions and populations associated with increased need for vitamin A includes young children particularly t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
R in d e rp es t It is also known as cattle plague resulting in high fever, diarrhoea and high mortality rates. In year 2006, OIE has declared that India is free from rin
In 1798, British economist and demographer Thomas Robert Malthus, published his' essay on population' in which he stated that: 1. Population increases in a geometric rat
Fumonisins The most recently characterized mycotoxins of any major significance in human health are the fumonisins produced by species of Fusarium, such as F. moniliforme. Like
what is radula?
A d v a nce d vaccine technology: Genetic engineering technology is the major scientific revolution of 20th Century. This has helped in developing vaccine
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd