Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is Prostetic group
Prostetic group:- A non-protein part of the enzyme which remains tightly bound to the protein part.
A person is declared to be dead upon the irreversible cessation of spontaneous body functions; brain activity, or blood circulation and respiration. However, only about 1% of a per
Describe Implant exposure ? Sound surgical principles to minimize the surgical exposure based on the access required should be employed. A series of surgical approaches to achie
why is PCR carried out under sterille conditions?
Role of Dietitian in Health Care The role of the dietitian has come a long way since the early 1900s. Their role is still unknown to a lot of people. Some think that dietitian
What is Binary Fission in cell reproduction? Cell division takes place in prokaryotic cells by binary fission, also called prokaryotic fission. In prokaryotes, DNA is contained
Hydrostatic Skeleton The functioning of the hydrostatic skeleton in an animal depends upon the musculature being arranged around an enclosed volume of fluid. After that, cont
Deoxyribonucleic Acid (DNA) - polymer of nucleotides containing genetic information that codes for proteins Nucleotide - a monomer of DNA consisting of a ribose/deoxyribose sug
Define Function of thiamin as Regulator of enzyme activity? Thiamin regulates the enzymes involved in carbohydrate metabolism. These are: a) Pyruvate dehydrogenase, which pr
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
N e c r otic enteritis It can be designated as enterotoxaemia of chickens, turkeys and ducks caused by Clostridium perfringens. The toxin released by this spore-bearing a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd