What is prostetic group, Biology

Assignment Help:

What is Prostetic group

Prostetic group:- A non-protein  part  of  the  enzyme which  remains  tightly bound to the protein part.

 


Related Discussions:- What is prostetic group

Explain how a person can be dead, A person is declared to be dead upon the ...

A person is declared to be dead upon the irreversible cessation of spontaneous body functions; brain activity, or blood circulation and respiration. However, only about 1% of a per

Implant exposure - implant surgery, Describe Implant exposure ? Sound su...

Describe Implant exposure ? Sound surgical principles to minimize the surgical exposure based on the access required should be employed. A series of surgical approaches to achie

Role of dietitian in health care, Role of Dietitian in Health Care The ...

Role of Dietitian in Health Care The role of the dietitian has come a long way since the early 1900s. Their role is still unknown to a  lot of people. Some think that dietitian

What is binary fission in cell reproduction, What is Binary Fission in cell...

What is Binary Fission in cell reproduction? Cell division takes place in prokaryotic cells by binary fission, also called prokaryotic fission. In prokaryotes, DNA is contained

Hydrostatic skeleton, Hydrostatic Skeleton The functioning of the hyd...

Hydrostatic Skeleton The functioning of the hydrostatic skeleton in an animal depends upon the musculature being arranged around an enclosed volume of fluid. After that, cont

Nucleic acids, Deoxyribonucleic Acid (DNA) - polymer of nucleotides contai...

Deoxyribonucleic Acid (DNA) - polymer of nucleotides containing genetic information that codes for proteins Nucleotide - a monomer of DNA consisting of a ribose/deoxyribose sug

Define function of thiamin as regulator of enzyme activity, Define Function...

Define Function of thiamin as Regulator of enzyme activity? Thiamin regulates the enzymes involved in carbohydrate metabolism. These are: a) Pyruvate dehydrogenase, which pr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Necrotic enteritis, N e c r otic enteritis It can be designated as ...

N e c r otic enteritis It can be designated as enterotoxaemia of chickens, turkeys and ducks caused by Clostridium perfringens. The toxin released by this spore-bearing a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd