What is predation rate coefficient, Biology

Assignment Help:

Consider an ecosystem consisting of a prey and a predator. If H is the density of prey, P is the density of predator, r is the intrinsic rate of prey population enhance and q is the predation rate coefficient, which of the following correctly shows change in prey population density with time?

a. dH/dT = rH + qP

b. dH/dT = rH - qHP

c. dH/dT = qH - rHP

d. dH/dT = qH + rHP

Related Discussions:- What is predation rate coefficient

Cardiac output and its determination, The cardiac output is the volume of b...

The cardiac output is the volume of blood pumped from the heart every minute. It is obtained by the volume pumped with each beat (stroke volume) multiplied by the heart rate. The c

Determine the osseus defects around implants, Osseus defects around implant...

Osseus defects around implants. They are classified into four main groups. Group I defects: These demonstrate moderate horizontal bone loss with a minimal intrabony component

Asphyxia, buffalo can be dies due ashyxia

buffalo can be dies due ashyxia

Define methods of estimation of ascorbic acid (vitamin c), Define Methods o...

Define Methods of Estimation of Ascorbic Acid (Vitamin C)? Ascorbic acid is also known as vitamin C which is a water soluble vitamin. As you already know, vitamins are a group

Define rhizoids - types of hyphae, Define Rhizoids - Types of Hyphae? ...

Define Rhizoids - Types of Hyphae? Rhizoids - These are brown slender root like structures which arise in cluster from each node of the stolon. These penetrate the substratum

Class arachnida of phylum arthropoda, Class Arachnida of Phylum Arthropoda ...

Class Arachnida of Phylum Arthropoda Body divided into cephalothorax and abdomen. Cephalothorax along with four (4) pairs of legs; abdomen segmented or unsegmented, with or wi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by hemodialysis, Q. What do you mean by hemodialysis? ...

Q. What do you mean by hemodialysis? Hemodialysis is the artificial blood filtration made by specific machines in alternative of the kidneys. Hemodialysis may be necessary in p

RNA synthesis, Distinguish features in the mechanisms of RNA synthesis, + (...

Distinguish features in the mechanisms of RNA synthesis, + (RNA), (-) RNA, and ds RNA viruses.

Crayfish, the appendages of arthropods; a. may serve as walking legs, b. ma...

the appendages of arthropods; a. may serve as walking legs, b. may be modified into atennae, c. may be modified into large pincers, or d. all of the above

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages