Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Consider an ecosystem consisting of a prey and a predator. If H is the density of prey, P is the density of predator, r is the intrinsic rate of prey population enhance and q is the predation rate coefficient, which of the following correctly shows change in prey population density with time?
a. dH/dT = rH + qP
b. dH/dT = rH - qHP
c. dH/dT = qH - rHP
d. dH/dT = qH + rHP
The cardiac output is the volume of blood pumped from the heart every minute. It is obtained by the volume pumped with each beat (stroke volume) multiplied by the heart rate. The c
Osseus defects around implants. They are classified into four main groups. Group I defects: These demonstrate moderate horizontal bone loss with a minimal intrabony component
buffalo can be dies due ashyxia
Define Methods of Estimation of Ascorbic Acid (Vitamin C)? Ascorbic acid is also known as vitamin C which is a water soluble vitamin. As you already know, vitamins are a group
Define Rhizoids - Types of Hyphae? Rhizoids - These are brown slender root like structures which arise in cluster from each node of the stolon. These penetrate the substratum
Class Arachnida of Phylum Arthropoda Body divided into cephalothorax and abdomen. Cephalothorax along with four (4) pairs of legs; abdomen segmented or unsegmented, with or wi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What do you mean by hemodialysis? Hemodialysis is the artificial blood filtration made by specific machines in alternative of the kidneys. Hemodialysis may be necessary in p
Distinguish features in the mechanisms of RNA synthesis, + (RNA), (-) RNA, and ds RNA viruses.
the appendages of arthropods; a. may serve as walking legs, b. may be modified into atennae, c. may be modified into large pincers, or d. all of the above
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd