Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is polygenic inheritance? How does it work?
The Polygenic inheritance, also called as quantitative inheritance, is the gene interaction in which a given trait is conditioned by numerous different genes having alleles that may or may not contribute to increase the phenotype intensity. The alleles may be noncontributing or contributing and there is no dominance among them and the Polygenic inheritance is the kind of inheritance, for instance, of skin color and of stature in humans.
Considering a given species of the animal in which the length of the individual is conditioned by polygenic inheritance of three genes, for the genotype having only noncontributing alleles (aabbcc) a basal phenotype, for instance, 30 cm, would emerge. Considering also that for every contributing allele a 5 cm increase in the length of the animal is added, so in the genotype having only contributing alleles (AABBCC) the animal would present the basal phenotype (30 cm) plus 30 cm more added by each contributing allele that is its length would be 60 cm. In case of triple heterozygosity, for instance, the length of the animal would be 45 cm. i.e. the way the polygenic inheritance works.
Nocardiosis Nocardiae are aerobic, saprophytic, gram-positive, partially acid-fast filamentous bacteria. Currently, there are 30 species included within the genus. Members of
Q. Pathophysiology of Chronic wasting disease? We all know that heart attack i.e. myocardial infarction is not the beginning but a last stage representing acute clinical manife
put the following events in the most probable order. A. Dead algae decomposed by bacteria B.excess nitrate and phosphate discharge into rivers C. Fish die of suffocation D.bacteria
Reducing Pollution - Conservation of wildlife As you already know, pollution of various kinds has affected the survival of living beings, particularly the wildlife in various
Calculation of Maximum Crop Yield Percent It was pointed out previously that 1 Baule of any growth factor is equal in effect on growth to the effect of 1 Baule of any other fa
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe Class Aves in details? Class Aves: The fossil record contains evidence that birds evolved from the reptiles. Birds share anatomical features with Protoavis and Archa
Solubility You are aware that gases are soluble in liquid. Solubility of a gas in a liquid depends on the partial pressure, temperature and presence of other solutes. Table
Q. What are the major biological functions in which chlorine ions participate? Like sodium cations, chlorine anions actively participate in the regulation of the osmolarity of
Q. What is the kind of reproduction that occurs in roundworms? What usual feature do nematode sperm cells have? Nematodes reproduce sexually. The nematode sperm cell does not h
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd