What is pollination, Biology

Assignment Help:

What is pollination? What are the main forms of pollination?

The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is known as pollination.

Characteristics of the flowers of every plant species relate to the type of pollination used by the plant. Colored flowers are specialized in bird and insect attraction; nocturnal flowers normally are white and perfumed, a lot of specialized in pollination by bats; the nectar is also a specialization to attract pollinator animals; flowers that make an exaggerated amount of pollen often use the wind as pollinator; the position of anthers more external or internal next to the nectar is a way to facilitate the pollen dissemination respectively by the wind or by animals.

 


Related Discussions:- What is pollination

Industrial effluents - causes of water pollution, Industrial Effluents - Ca...

Industrial Effluents - Causes of Water Pollution Most industrial operations produce effluents that are discharged into nearby river or any other water body. The industrial eff

What is the autotrophic hypothesis on the origin of life, What is the autot...

What is the autotrophic hypothesis on the origin of life? The autotrophic hypothesis on the origin of life asserts that the first living beings on earth were producers of thei

Occupational lung diseases, Occupational Lung Diseases The common occu...

Occupational Lung Diseases The common occupational lung diseases include silicosis due to inhalation of inorganic dust, allergic alveolitis due to inhalation of organic dus

How much protein is in the red blood cell, I need a list of equipment neces...

I need a list of equipment necessary to complete it as well as a method to isolate the cell parts, how much protein is in the red blood cell as well as the amount of DNA in the cel

Define the drug and drug effect, Define the Drug and Drug Effect? In th...

Define the Drug and Drug Effect? In the discussions above, we reviewed the effect of food on drug metabolism. Interestingly, not only can drugs interact with food and alcohol,

Surgical treatment of infective endocarditis, Cardiac surgical intervention...

Cardiac surgical intervention has an increasingly important role in the treatment of intracardiac complications of endocarditis. Retrospective data suggest that mortality is unacce

Telophase of karyokinesis, - The chromosomes at each pole uncoil and elonga...

- The chromosomes at each pole uncoil and elongate to form the chromatin. - A nucleolus reappears at each pole. - Spindle fibers and asters disappear and centrioles split. - A nu

Illustrate the applications of vitamin D, Illustrate the Applications of Vi...

Illustrate the Applications of Vitamin D Vitamin D 2 is mainly used in the preparation of various drug formulations. For the animal feed industry, a mineral stable dry powder

Structural function - essential elements, Structural Function - Essential E...

Structural Function - Essential Elements The elements nitrogen, phosphorus and sulphur absorbed from the soil are essential components of amino acids and nucleotides. The othe

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd