Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is pleiotropy?
Pleiotropy (or pliotropy) is the occurrence in which a single gene conditions several dissimilar phenotypical traits.
Some phenotypical traits might be sensitive to pleiotropic effects (for instance, inhibition) of other genes, even when conditioned by a pair of alleles in simple dominance. In these cases a mixture of pleiotropy and gene interaction is characterized.
Image Diversity: pleiotropy
What two abiotic factors might affect (a) an animal living at the bottom of the sea, (b) a plant growing on a mountainside? (a) The abiotic factors which might
Types of Stress Caused by Freezing Thus, freezing can cause the following kinds of stresses Lowering of temperature to suboptimum thus reducing the activity of mo
Are nematodes diploblastic or triploblastic animals? Just like platyhelminthes, nematodes are triploblastics, i.e., they show three germ layers (ectoderm, mesoderm and endoder
Define Antiketogenic Effect of Carbohydrate? Presence of carbohydrates is necessary for normal fat metabolism. In the absence of sufficient carbohydrates, larger amounts of fat
What do you understand by Pharynx? The region of digestive tract between the mouth and esophagus. In most animals it's muscular and forces food into the digestive tract which l
Case scenario Mr Kit Lee, a 28-year-old unrestrained driver of a utility, was travelling on a highway at 100kph and swerved to miss road debris. He lost control and struck a tre
Define Fluconazole It is a weaker inhibitor of CYP3A4 than itraconazole or ketoconazole but may still increase serum concentrations of drugs metabolized by 3A4, like cyclospor
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Do squids and octopus have exoskeleton? Squids and Octopus generally do not produce external shell (some squid species can have an internal shell). One cephalopod group the
What is the futile cycle The futile cycle is avoided because covalent modification, by phosphorylation, has opposite effects on the enzymes concerned with the synthesis a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd