What is pleiotropy, Biology

Assignment Help:

What is pleiotropy?

Pleiotropy (or pliotropy) is the occurrence in which a single gene conditions several dissimilar phenotypical traits.

Some phenotypical traits might be sensitive to pleiotropic effects (for instance, inhibition) of other genes, even when conditioned by a pair of alleles in simple dominance. In these cases a mixture of pleiotropy and gene interaction is characterized.

Image Diversity: pleiotropy

 


Related Discussions:- What is pleiotropy

A plant growing on a mountainside, What two abiotic factors might affect (a...

What two abiotic factors might affect (a) an animal living at the bottom of the sea, (b) a plant growing on a mountainside?   (a) The abiotic factors which might

Types of stress caused by freezing, Types of Stress Caused by Freezing ...

Types of Stress Caused by Freezing Thus, freezing can cause the following kinds of stresses Lowering of temperature to suboptimum thus reducing the activity of mo

Are nematodes diploblastic or triploblastic animals, Are nematodes diplobla...

Are nematodes diploblastic or triploblastic animals? Just like platyhelminthes, nematodes are triploblastics, i.e., they show three germ layers (ectoderm, mesoderm and endoder

Define antiketogenic effect of carbohydrate, Define Antiketogenic Effect of...

Define Antiketogenic Effect of Carbohydrate? Presence of carbohydrates is necessary for normal fat metabolism. In the absence of sufficient carbohydrates, larger amounts of fat

What do you understand by pharynx, What do you understand by Pharynx? T...

What do you understand by Pharynx? The region of digestive tract between the mouth and esophagus. In most animals it's muscular and forces food into the digestive tract which l

Pathophysiology, Case scenario Mr Kit Lee, a 28-year-old unrestrained dr...

Case scenario Mr Kit Lee, a 28-year-old unrestrained driver of a utility, was travelling on a highway at 100kph and swerved to miss road debris. He lost control and struck a tre

Define fluconazole, Define Fluconazole It is a weaker inhibitor of CYP...

Define Fluconazole It is a weaker inhibitor of CYP3A4 than itraconazole or ketoconazole but may still increase serum concentrations of drugs metabolized by 3A4, like cyclospor

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Do squids and octopus have exoskeleton, Q. Do squids and octopus have exosk...

Q. Do squids and octopus have exoskeleton? Squids and Octopus generally do not produce external shell (some squid species can have an internal shell). One cephalopod group the

What is the futile cycle, What is the futile cycle The futile cycle is ...

What is the futile cycle The futile cycle is avoided because covalent modification, by  phosphorylation, has opposite effects on  the  enzymes concerned with  the  synthesis  a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd