Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is packaging?
What is packaging? Packaging means a coordinated system of preparation of goods (in this case, foods) for shipment, distribution, storage and marketing at optimum costs, compatible with the requirements of the product. It has a protective role as a means of ensuring safe delivery of the products in sound conditions to the final user at a minimum cost. Packaging becomes even more important when dealing with foods and pharmaceuticals, since a large amount of food products becomes inedible due to spoilage for the want of adequate packaging. Thus, to save the food from spoilage, primary packaging is of utmost importance, especially in developing countries. Packaging includes the art, science and technology used initially and during transportation along with the selling and technical methods and work processes related to the above preparations.
You may be aware of the various materials that are used for the packaging of food products. The packaging material is very crucial in the packaging process. What in your opinion is a packaging material? In simple terms, any physical material which serves as a covering, wrap or seal for an object or material is a packaging material. Selection of the kind of packaging and packaging material is based on the type of food that needs to be packaged. It also involves identifying the kind of equipment to be used and to label the package suitably.
Deep fat frying Deep fat frying, as you may already know, is the method which involves cooking food in hot fat/oil. The fat immediately surrounds the food and cooks it from all
There may also be non-use existence values for components of biological diversity due to the value placed on biodiversity purely based on its continued existence, irrespective of w
.respiration in animals
Criteria for Diagnosis of Respiratory Failure PaO 2 , PaCO 2 , > 50 mm Hg. Vital Capacity Respiration > 30/min or below 8/min.
what are the alpha taxonomy?
Define General protection in the Laboratory? You are required to wear a laboratory coat at all times in the laboratory. It is sensible to buy one of good quality and to launder
Metabolic Alterations and the Resultant Nutritional Problems/ Clinical Manifestations Associated With Cancer? Several research studies have shown that malignant growth (cancer)
Why is sex-linked inheritance an example of nonmendelian inheritance? The Sex-linked inheritance is a kind of nonmendelian inheritance because it opposes Mendel's first law, wh
During the course of a physiology laboratory, a student finds that her PR interval is 0.24 second. Concerned, she takes her own ECG again an hour later and sees an area of the ECG
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd