What is packaging, Biology

Assignment Help:

Q. What is packaging?

What is packaging? Packaging means a coordinated system of preparation of goods (in this case, foods) for shipment, distribution, storage and marketing at optimum costs, compatible with the requirements of the product. It has a protective role as a means of ensuring safe delivery of the products in sound conditions to the final user at a minimum cost. Packaging becomes even more important when dealing with foods and pharmaceuticals, since a large amount of food products becomes inedible due to spoilage for the want of adequate packaging. Thus, to save the food from spoilage, primary packaging is of utmost importance, especially in developing countries. Packaging includes the art, science and technology used initially and during transportation along with the selling and technical methods and work processes related to the above preparations.

You may be aware of the various materials that are used for the packaging of food products. The packaging material is very crucial in the packaging process. What in your opinion is a packaging material? In simple terms, any physical material which serves as a covering, wrap or seal for an object or material is a packaging material. Selection of the kind of packaging and packaging material is based on the type of food that needs to be packaged. It also involves identifying the kind of equipment to be used and to label the package suitably.


Related Discussions:- What is packaging

Explain deep fat frying method, Deep fat frying Deep fat frying, as you...

Deep fat frying Deep fat frying, as you may already know, is the method which involves cooking food in hot fat/oil. The fat immediately surrounds the food and cooks it from all

Existence value of biodiversity, There may also be non-use existence values...

There may also be non-use existence values for components of biological diversity due to the value placed on biodiversity purely based on its continued existence, irrespective of w

Criteria for diagnosis of respiratory failure, Criteria for Diagnosis of Re...

Criteria for Diagnosis of Respiratory Failure PaO 2 , PaCO 2 , > 50 mm Hg.  Vital Capacity Respiration > 30/min or below 8/min.

1, what are the alpha taxonomy?

what are the alpha taxonomy?

Define general protection in the laboratory, Define General protection in t...

Define General protection in the Laboratory? You are required to wear a laboratory coat at all times in the laboratory. It is sensible to buy one of good quality and to launder

Metabolic alterations and nutritional problems - cancer, Metabolic Alterati...

Metabolic Alterations and the Resultant Nutritional Problems/ Clinical Manifestations Associated With Cancer? Several research studies have shown that malignant growth (cancer)

Define sex-linked inheritance of nonmendelian inheritance, Why is sex-linke...

Why is sex-linked inheritance an example of nonmendelian inheritance? The Sex-linked inheritance is a kind of nonmendelian inheritance because it opposes Mendel's first law, wh

Normal pattern reappears, During the course of a physiology laboratory, a s...

During the course of a physiology laboratory, a student finds that her PR interval is 0.24 second. Concerned, she takes her own ECG again an hour later and sees an area of the ECG

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd