Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is packaging?
What is packaging? Packaging means a coordinated system of preparation of goods (in this case, foods) for shipment, distribution, storage and marketing at optimum costs, compatible with the requirements of the product. It has a protective role as a means of ensuring safe delivery of the products in sound conditions to the final user at a minimum cost. Packaging becomes even more important when dealing with foods and pharmaceuticals, since a large amount of food products becomes inedible due to spoilage for the want of adequate packaging. Thus, to save the food from spoilage, primary packaging is of utmost importance, especially in developing countries. Packaging includes the art, science and technology used initially and during transportation along with the selling and technical methods and work processes related to the above preparations.
You may be aware of the various materials that are used for the packaging of food products. The packaging material is very crucial in the packaging process. What in your opinion is a packaging material? In simple terms, any physical material which serves as a covering, wrap or seal for an object or material is a packaging material. Selection of the kind of packaging and packaging material is based on the type of food that needs to be packaged. It also involves identifying the kind of equipment to be used and to label the package suitably.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
This problem refers to the MN and ABO loci mentioned in class. It also refers to the Rh locus, which is responsible for the positive/negative part of the blood type. The Rh+ allele
Biological energy: Whenever matter is broken down its chemical energy is released as heat. Non biological system can utilize this heat energy directly in the performance of work,
differences of plants and animals in terms of form and structure?
What are diseases of the connective tissue? What are some of them? Diseases of the connective tissue are hereditary or acquired diseases(lots of autoimmune cause) characterized
a soil surface of 10cm2 may contain what type of hyphae?
#questitypes of plant breeding on..
Q. Is the epithelium vascularized? How do oxygen and nutrients reach the epithelium? Why is this feature an important evolutionary acquisition? Epithelia are not vascularized c
What is the connection among this substance, mouth bacteria and tooth decay? Mouth bacteria use sugar for their metabolism and produce acids as a waste-product. The acids diss
Define tuberculosis Tuberculosis (TB) is still a problem in the United States, even though the incidence continues to decline in most of the country. Treatment of TB can be div
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd