Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is mutualism?
The Mutualism is the ecological interaction in which both participants advantage and that is obligatory for their survival.
The Mutualism is a harmonious (positive) ecological interaction. The Mutualism is as well known as symbiosis. Instance of mutualism are the association between microorganisms that digest cellulose and the ruminants or insects within which they live the lichens, formed by cyanobacteria or algae that make organic material for the fungi and absorb water with their help nitrifying bacteria of the genus Rhizobium that associated to leguminous plants offer nitrogen to these plants.
What is a stream? A stream is a incessant series of bytes that flow into or out of your program. Input and output from devices like the mouse, , disk, keyboard, screen, modem, a
Define about the Manganese Deficiency? Mn deficiency has been observed in many species of animals and symptoms include: impaired growth, skeletal abnormalities, depressed repro
Define Potential Health benefits from resistant starch? Like dietary fibre, RS can also play a potential role in helping to maintain or improve health of an individual. As you
Platinum color in foxes is produced by heterozygous genotype Ss, and silver foxes are the genotype SS. The genotype ss is lethal, and the fox dies in early embryonic development. I
Explain Echinocandins It inhibit synthesis of β (1,3)-D-glucan, an essential component of the fungal cell wall. The potential for adverse effects in humans is low because of th
why are proteins so versatile?
Long-Day Plants (LDP) - Plant Responses to Light-Dark Cycles The definition of this is exactly opposite to short-day plant. That is those plants which flower when given more t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Pigs This is a sub-acute or chronic infection manifested by abortion, sterility, high piglet mortality and orchitis in pigs. Br. suis causes brucellosis among pigs. It is morph
What are the predominating chemical compounds respectively in eggshell, white and yolk? The eggshell is essentially made of calcium carbonate. The white, or albumen, is compose
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd