What is mnt, Biology

Assignment Help:

What is MNT

MNT starts with the assessment of nutritional  status of  patient  with  a condition, illness or injury that puts  them at risk. This includes the review and analysis of medical and diet history, laboratory values and anthropometric measurements. Based on the assessment, a nutrition care plan, most appropriate to manage the condition or  treat the  illness  or injury is  formulated. The MNT  also includes intervention and evaluation of  achievement of  desired clinical outcomes. Appropriate medical nutrition therapy provided by the dietetics professional has been shown to result in health benefits and reduced health care costs.

 


Related Discussions:- What is mnt

Importance of forests - habitat and food, Importance of Forests - Habitat a...

Importance of Forests - Habitat and Food Forests provide habitat, and food as well as protection to wildlife species against extremes of climate and help in balancing carbon d

Management of diabetes, By now you know that diabetes cannot be cured but c...

By now you know that diabetes cannot be cured but can be treated so that an individual leads a normal life. Patients who maintain their blood glucose levels within the normal range

Define the bioavailability of vitamin k, Define the Bioavailability of Vita...

Define the Bioavailability of Vitamin K? Very little is known about the bioavailability of the K vitamins from different foods.  It has been estimated that the efficiency of ab

Define classification of carbohydrates - oligosaccharides, Define classific...

Define classification of carbohydrates - Oligosaccharides? Oligosaccharides are short chains of saccharide units and are condensation products of three to ten monosaccharides.

Goal of bcc programme, The overall goal of BCC programs for diabetes mellit...

The overall goal of BCC programs for diabetes mellitus is to promote behaviors that control diabetes mellitus and prevent complications. These include: Following treatment

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Advantages of implant supported maxillo-facial prosthesis, Q. Discuss the a...

Q. Discuss the advantages of implant supported maxillo-facial prosthesis. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acq

Define light source of microscope, Define Light Source of Microscope? I...

Define Light Source of Microscope? It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with

Altered fat metabolism - metabolic response to injury, Altered Fat Metaboli...

Altered Fat Metabolism - Metabolic Response to Injury? The stored fat deposiis are mobilized and oxidized at a high rate in order to support hyper metabolism and increased gluc

Energy requirements to get ideal body weight, Q. Energy requirements to get...

Q. Energy requirements to get ideal body weight? Calories: The energy requirements of adult patients is governed by their present body weight and the need to maintain a desira

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd