Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is MNT
MNT starts with the assessment of nutritional status of patient with a condition, illness or injury that puts them at risk. This includes the review and analysis of medical and diet history, laboratory values and anthropometric measurements. Based on the assessment, a nutrition care plan, most appropriate to manage the condition or treat the illness or injury is formulated. The MNT also includes intervention and evaluation of achievement of desired clinical outcomes. Appropriate medical nutrition therapy provided by the dietetics professional has been shown to result in health benefits and reduced health care costs.
Importance of Forests - Habitat and Food Forests provide habitat, and food as well as protection to wildlife species against extremes of climate and help in balancing carbon d
By now you know that diabetes cannot be cured but can be treated so that an individual leads a normal life. Patients who maintain their blood glucose levels within the normal range
Define the Bioavailability of Vitamin K? Very little is known about the bioavailability of the K vitamins from different foods. It has been estimated that the efficiency of ab
Define classification of carbohydrates - Oligosaccharides? Oligosaccharides are short chains of saccharide units and are condensation products of three to ten monosaccharides.
The overall goal of BCC programs for diabetes mellitus is to promote behaviors that control diabetes mellitus and prevent complications. These include: Following treatment
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Discuss the advantages of implant supported maxillo-facial prosthesis. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acq
Define Light Source of Microscope? It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with
Altered Fat Metabolism - Metabolic Response to Injury? The stored fat deposiis are mobilized and oxidized at a high rate in order to support hyper metabolism and increased gluc
Q. Energy requirements to get ideal body weight? Calories: The energy requirements of adult patients is governed by their present body weight and the need to maintain a desira
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd