What is mendels second law, Biology

Assignment Help:

What is Mendel's second law?

Mendel's second law postulates that two or more different traits are also conditioned by two or more pair of dissimilar factors and that each inherited pair divides independently from the others. In other words, gametes are produced always with an aleatory representative of every pair of the factors that determine phenotypical characteristics.

Mendel's second law is also known as the law of independent segregation of factors, or law of independent assortment.

 


Related Discussions:- What is mendels second law

Dietary management for short bowel syndrome, Q. Dietary Management for shor...

Q. Dietary Management for short bowel syndrome? It must be evident from the symptoms listed above that the disease results in reduced food intake, impaired absorption and hence

Neurotransmitters, Neurotransmitters We know that transmission of sign...

Neurotransmitters We know that transmission of signals from nerves to muscles is affected by acetylcholine a transmitter substance. Similarly neuron-neuron transmission is als

Conduction, Conduction An action potential occurs at one point along t...

Conduction An action potential occurs at one point along the axon. Yet we know that neurological impulses are not fixed, they travel along a neuron. So how can the action pote

Microfilaments - cytoskeletal structures, MICROFILAMENTS Discovered ...

MICROFILAMENTS Discovered by Pelvitz. These are smallest cell structure. These are non-living structures. These are solid structures, consists of actin protein (c

What is pupillary reflexes, Pupillary reflexes There are two types of r...

Pupillary reflexes There are two types of reflexes which control the pupillary reaction-the light reflex and near reflex. When light is shown on one eye, there is a constrictio

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Salmonellosis in poultry, Salmonellosis in poultry A wide variety of se...

Salmonellosis in poultry A wide variety of serovars are prevalent among chicken, turkeys, ducks and geese. The poultry is an important reservoir of salmonellae. The common dise

Pathology of mitral regurgitation, Q. Pathology of mitral regurgitation? ...

Q. Pathology of mitral regurgitation? During left ventricular systole as the pressure rises in left ventricle, blood is pumped simultaneously both into aorta and left atrium. T

Which are the three parts of the small intestine, Which are the three parts...

Which are the three parts of the small intestine? The small intestine is separated into three portions: duodenum, jejunum and ileum. Digestion System - Image Diversity: smal

Types of growth, KINDS OF GROWTH - 1 .      AUXETIC GROWTH - Body...

KINDS OF GROWTH - 1 .      AUXETIC GROWTH - Body grows by enlargement of its cells without increase in number of cells. eg. Nematodes, rotifers, tunicates. Growth of b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd