Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is Mendel's second law?
Mendel's second law postulates that two or more different traits are also conditioned by two or more pair of dissimilar factors and that each inherited pair divides independently from the others. In other words, gametes are produced always with an aleatory representative of every pair of the factors that determine phenotypical characteristics.
Mendel's second law is also known as the law of independent segregation of factors, or law of independent assortment.
Q. Dietary Management for short bowel syndrome? It must be evident from the symptoms listed above that the disease results in reduced food intake, impaired absorption and hence
Neurotransmitters We know that transmission of signals from nerves to muscles is affected by acetylcholine a transmitter substance. Similarly neuron-neuron transmission is als
Conduction An action potential occurs at one point along the axon. Yet we know that neurological impulses are not fixed, they travel along a neuron. So how can the action pote
MICROFILAMENTS Discovered by Pelvitz. These are smallest cell structure. These are non-living structures. These are solid structures, consists of actin protein (c
Pupillary reflexes There are two types of reflexes which control the pupillary reaction-the light reflex and near reflex. When light is shown on one eye, there is a constrictio
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Salmonellosis in poultry A wide variety of serovars are prevalent among chicken, turkeys, ducks and geese. The poultry is an important reservoir of salmonellae. The common dise
Q. Pathology of mitral regurgitation? During left ventricular systole as the pressure rises in left ventricle, blood is pumped simultaneously both into aorta and left atrium. T
Which are the three parts of the small intestine? The small intestine is separated into three portions: duodenum, jejunum and ileum. Digestion System - Image Diversity: smal
KINDS OF GROWTH - 1 . AUXETIC GROWTH - Body grows by enlargement of its cells without increase in number of cells. eg. Nematodes, rotifers, tunicates. Growth of b
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd