What is meant by the arch reflex, Biology

Assignment Help:

What is meant by the arch reflex?

In some situations the movement of the skeletal striated muscles does not depend upon commands of the superior motor neurons, i.e., it is not triggered by volition.

Involuntary movements of those muscles might be happen when sensory fibers that make direct or indirect connection with inferior motor neurons are unexpectedly stimulated in situations that suggest danger to the body. This occurs, for example, in the patellar reflex, or knee jerk reflex, when a sudden percussion on the knee patella (kneecap) triggers an involuntary contraction of the quadriceps (the extension muscle of the thigh). Another instance of the arch reflex happens when someone steps on a sharp object: one leg retracts and the other, by the arch reflex, distends to maintain the equilibrium of the body.

 


Related Discussions:- What is meant by the arch reflex

Explain the absorption of protein, Explain the Absorption of Protein? A...

Explain the Absorption of Protein? Although single amino acids are liberated in the intestinal contents, there is insufficient power in the enzymes of the pancreatic juice to r

What is hmp pathway, What is HMP pathway? Give any two points of its signif...

What is HMP pathway? Give any two points of its significance The HMP  is an alternate oxidative pathway for the metabolism of glucose. The significance of the pathway  is that

Explain the indirect methods of microbial estimation, Explain the Indirect ...

Explain the Indirect Methods of Microbial Estimation? Indirect methods, i.e., methods other than those counting the microbial cells can also be used for quantitation purpose. T

Eating foods with high sweetness, Why would a tongue not detect mild sweetn...

Why would a tongue not detect mild sweetness after eating foods with high sweetness? This happens due to of the "desensitization" of sensory receptors on the sensory cells of y

Use of masks as personal protective equipment, Q. Use of Masks as personal ...

Q. Use of Masks as personal protective equipment? Masks are to be worn when procedures that result in aerosol production are performed. Protection from these masks only affords

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the working of cyclomixer, Define the working of Cyclomixer? Thi...

Define the working of Cyclomixer? This is an electrical mixer used for mixing the contents of a test tube. The speed of the mixer can be adjusted to your requirement. This is a

Define anaerobic exercise or energy system, Define Anaerobic Exercise or En...

Define Anaerobic Exercise or Energy System? Thus, exercises which are done for short bursts of time lasting only for few seconds (less than 120 sec) use only anaerobic system o

What is the menstrual cycle, What is the menstrual cycle? The menstrual...

What is the menstrual cycle? The menstrual cycle is the periodic succession of interactions among hormones and the organs of the female reproductive system that, after the star

Homologous structures, Homologous structures are the body parts in differe...

Homologous structures are the body parts in different organisms which have similar bones and similar arrangements of the blood vessels, muscles, and nerves and go through similar

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd