What is lyophobic, Biology

Assignment Help:

What is lyophobic

If the affinity of the dispersed phase to go into or to remain in colloidal dispersion is slight, the dispersed phase is said to be lyophobic (solvent repelling) or hydrophobic when the medium is water. Oil dispersed in water as in the case of butter and margarine, is an example of a lyophobic system. Lyophobic colloids are mainly the aqueous dispersions of inorganic substances rarely recountered in food systems.  

 


Related Discussions:- What is lyophobic

Why d scientists pick hydrogen as the basis for mri scanning, Why d scienti...

Why d scientists pick hydrogen as the basis for MRI scanning? Name of the human body that do not appear in an MRI scan. Explain thermal stratification? How does thermal stratifi

Which is the autotrophic group responsible for production, Which is the aut...

Which is the autotrophic group responsible for the production of most part of the molecular oxygen of earth? Cyanobacteria and Algae of the phytoplankton are the organisms that

What is the senses explain their vision , What is the Senses explain their ...

What is the Senses explain their Vision ? Vision :  The human eye consists of structures which evolved together to focus light on a sensitive area called the retina. Light f

Development of endosperm, Development of Endosperm In a fertilized emb...

Development of Endosperm In a fertilized embryo sac, the primary endosperm nucleus is generally observed below the zygote. It divides, and further divisions of its products gi

Illustrate wild life sanctuaries, Q. Illustrate Wild Life Sanctuaries? ...

Q. Illustrate Wild Life Sanctuaries? You must have seen how some of the parks are fenced. The intention is to keep the animals from wandering out and not to destroy neighbourin

Acid-base imbalances from appearing in the body, List and briefly describe ...

List and briefly describe the mechanisms that prevent acid-base imbalances from appearing in the body. In addition, indicate where each mechanism functions most significantly.

Describe the significance of micronucleus., Describe the significance of mi...

Describe the significance of micronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. The single micronucleus contains only one copy of the genome and is

Characteristics of female''s skeleton, CHARACTERISTICS OF FEMALE'S SKELETON...

CHARACTERISTICS OF FEMALE'S SKELETON - 1.      Skull is lighter. 2.      Shoulders are nanow. 3.      Sacrum is shorter but wider. 4.      Pelvis is wider. 5.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How to promote physical activity to combat from obesity, How to Promote Phy...

How to Promote Physical Activity to combat from Obesity? For many children, low physical activity rather than excessive energy intake is the primary culprit. Management of obes

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd