Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is lyophobic
If the affinity of the dispersed phase to go into or to remain in colloidal dispersion is slight, the dispersed phase is said to be lyophobic (solvent repelling) or hydrophobic when the medium is water. Oil dispersed in water as in the case of butter and margarine, is an example of a lyophobic system. Lyophobic colloids are mainly the aqueous dispersions of inorganic substances rarely recountered in food systems.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Transportation of Sick Newborn Infants with Heart Disease Communication : The decision to transport a newborn to a tertiay referral centre with facilities for specia
Q. Concerning the thickness of their walls how different are the heart chambers? The ventricle walls are thicker than the atrium walls since ventricles are structures responsib
FORM S OF RIBOSOMES (1 ) Bound form - Attached to ER. Protein synthesis for secretion purpose occurs on bound ribosomes. (2 ) Free Ribosomes - Occur freely
Q. Which are the two major metabolic gases transported by the blood? The major metabolic gases transported by the blood are molecular carbon dioxide (CO 2 ) and oxygen (O 2 ).
The conduction of impulse in a nerve fibre is. a electrochemical process. Maximum speed of transmission of nerve impulse can be 13 metre/second due to axoplasm is much resistant to
A In taxonomy, what is a "KEY" ? List the different types of keys. How are they prepared and what are they used for ?sk question #Minimum 100 words accepted#
Percussive instruments -Crown and bridge remover CORONA flex I. Nitch -it's tip look like the curette and has hock -4 or 5 tips according to tooth position and accessib
Would you expect the muscle fibers of the tongue to be striated or smooth? What about the muscle of the diaphragm/ Explain your answer.
Which of the below describes the type of fruit characterized as a dry, simple, one-seeded indehiscent (pron: in-deh-HISS-ent) fruit with seed attached to one ovary wall at only one
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd