Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is lyophobic
If the affinity of the dispersed phase to go into or to remain in colloidal dispersion is slight, the dispersed phase is said to be lyophobic (solvent repelling) or hydrophobic when the medium is water. Oil dispersed in water as in the case of butter and margarine, is an example of a lyophobic system. Lyophobic colloids are mainly the aqueous dispersions of inorganic substances rarely recountered in food systems.
Why d scientists pick hydrogen as the basis for MRI scanning? Name of the human body that do not appear in an MRI scan. Explain thermal stratification? How does thermal stratifi
Which is the autotrophic group responsible for the production of most part of the molecular oxygen of earth? Cyanobacteria and Algae of the phytoplankton are the organisms that
What is the Senses explain their Vision ? Vision : The human eye consists of structures which evolved together to focus light on a sensitive area called the retina. Light f
Development of Endosperm In a fertilized embryo sac, the primary endosperm nucleus is generally observed below the zygote. It divides, and further divisions of its products gi
Q. Illustrate Wild Life Sanctuaries? You must have seen how some of the parks are fenced. The intention is to keep the animals from wandering out and not to destroy neighbourin
List and briefly describe the mechanisms that prevent acid-base imbalances from appearing in the body. In addition, indicate where each mechanism functions most significantly.
Describe the significance of micronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. The single micronucleus contains only one copy of the genome and is
CHARACTERISTICS OF FEMALE'S SKELETON - 1. Skull is lighter. 2. Shoulders are nanow. 3. Sacrum is shorter but wider. 4. Pelvis is wider. 5.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How to Promote Physical Activity to combat from Obesity? For many children, low physical activity rather than excessive energy intake is the primary culprit. Management of obes
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd