Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define lipids
'lipids' defines substances as oils, fats and waxes which can be only characterized by a large array of properties. They are in general:
- coming from plant and animal origin;
- insoluble or immiscible with water but soluble in organic solvents such as chloroform, ether, benzene, acetone; and
- formed of long-chain hydrocarbon groups (carbon and hydrogen), but may also contain oxygen, phosphorous, nitrogen and sulphur.
ORGANIC COMPOUNDS - They are substances having both carbon and hydrogen which are commonly biological in origin. Organic compounds can be micromolecules or macromolecules
what are the types of autoclaves
What are the functions of the Eyelids? Functions of the Eyelids: The eyelid makes the outer most layers, covering the eye. Because of its strategic position, the eyelid s
A student set up a potometer in the laboratory and measured the rate of movement of water in the capillary. An average of four readings gave a rate of 50mm per minute. The apparatu
Q Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.
ORGANIZER THEORY - It was propounded by spemann (1901). He was given Nobel prize of 1935 for this wrok. He studied the embryonic development of frog, newt & other amph
Closed Mitral Valvotomy : This has been 1-eplaced by balloon mitral valvotomy (BMV) in most centres. It is done in cases of either pure mitral stenosis or with .triv
Explain Precautions for Determination of Fungal and Yeast Count? 1. Maintain aseptic conditions. 2. Keep alcohol away from flame. 3. To avoid infections and allergies, ca
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. In arthropods why isn't gas exchange done through cutaneous diffusion? In arthropods the impermeability of the exoskeleton makes the way of gases difficult. In addition the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd