What is leaf morphology, Biology

Assignment Help:

What is Leaf Morphology?

49_Leaf Arrangement.png

Leaf Arrangement : These show the different types of leaf arrangement on a twig. The point on the twig at which the leaves are attached is referred to as a "node." Alternate leaf arrangement is when a single leaf is attached to the stem at a node, and the next adjacent leaf on the stem points in a different direction. If two leaves occur at the same node and are 180 degrees apart, it is called an opposite leaf arrangement. Three or more leaves attached at the same node forms a whorled leaf arrangement.

736_Compound Leaves.png

Compound Leaves : A single leaf on a petiole, or stalk, is called a simple leaf. In many cases, the leaf is divided into sub parts, or leaflets, and these are then called compound leaves. A leaf with its leaflets radiating from one point like the fingers from the palm of your hand is called a palmately compound leaf. If the leaflets are formed in a feather-like fashion, the leaf is called pinnately compound. If the feather-like leaflets themselves are divided into smaller feather like leaflets, the compound leaves are called doubly pinnate.

970_Leaf Margins.png

Leaf Margins : The edges of a leaf blade are referred to as leaf margins. Leaf margins can be highly variable, and come in 4 main types. An entire leaf margin is a margin that has a smooth and unbroken edge. A serrated margin is one that has teeth-like points, a lobed leaf has deep cut indentations, and an undulate leaf edge has gentle, wave like edges.

770_Leaf Shapes.png

Leaf Shapes : The shapes of leaf blades is also variable. A lanceolate leaf has the shape of a lance, or spear, blade. Oval and triangular leaf shapes are self-explanatory, and a cordate shaped leaf has the shape of a heart.

Leaf Venation : The veins that serve leaves form fairly typical arrangements, or patterns. Parallel venation is found in monocots, and reticulate, or netted patterns are found in dicots. Palmate leaf venation resembles a pattern formed by fingers radiating from the palm of your hand, and pinnately net venation resembles the pattern found in the pinna of feathers.


Related Discussions:- What is leaf morphology

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Staging of heart failure, In this unit you have learnt that heart failure i...

In this unit you have learnt that heart failure is one of the most common conditions seen and results in a high mortality. It can result from failure of the heart muscle as with co

How to measure post repair prv/iv pressure, How to measure Post Repair Prv/...

How to measure Post Repair Prv/iv Pressure ? In the operating room, after coining of1 bypass and before removing cannulae the RV and LV pressures are measured. The pressures ar

Deficiency diseases, DEFICIENCY DISEASES Animals may suffer from diseases...

DEFICIENCY DISEASES Animals may suffer from diseases caused by deficiencies of energy and proteins, mineral nutrients and vitamins, which generally occur either due to deficiency

Secretion of parathormone and calcium blood level, Q. What is the relation ...

Q. What is the relation between secretion of parathormone and the calcium blood level? The parathormone increases the calcium blood level since it stimulates the resorption (re

Determine condensation foam method, Determine condensation foam method ...

Determine condensation foam method In the condensation method a pressurized solution is suddenly released  to expand the number of gas bubbles which their ripe through the liqu

Determine the occurrence of vitamin A, Determine the Occurrence of vitamin ...

Determine the Occurrence of vitamin A In the vegetable kingdom, vitamin A  probably occurs in the form of its provitamins which belong to the group of carotenes. Carrots, spina

Explain the uses of iso in dairy-type products, Normal 0 false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Of which type of defense cell do worm infections, Q. Of which type of defen...

Q. Of which type of defense cell do worm infections stimulate the multiplication? The main leukocytes that generally participate and multiply in the defense against worm infect

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd