Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is katal
katal : the amount of enzyme that transforms 1 mol of substrate into product in one second.
Define Dietary Management of Sepsis with or without MODS? Before we begin with the dietary management of patients suffering from sepsis with or without MODS let us read a case
Why is the proximity between ribosomes and amino acids important for the protein formation? What is the enzyme that catalyzes that reaction? The proximity among ribosomes and a
Circulation of nutrients in the coastal zone Circulation of nutrients from the sea bottom to the upper surface, occurs in the coastal regions by two processes Upwelling
Clinical Manifestations Can be chronic to acute, mild to severe. Acute attack often occur at night. During an acute attack, audible inspiratory and expiratory wheezing. Patie
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How are the circulatory systems of animals classified? A circulatory system is classified as open or closed. In open circulatory systems blood gets out of vessels and flows
A In taxonomy, what is a "KEY" ? List the different types of keys. How are they prepared and what are they used for ?sk question #Minimum 100 words accepted#
Explain the Klebsiella - Characteristics of Bacteria? It is gram negative, non-sporulating, non-motile and non-pigmented rod, which is commonly found in soil or water. It is th
how to identified plants
Fuel Requirements - Deforestation The increasing demand for fuel wood is one of the major factors leading to the degradation of the forest ecosystem. Fuel wood is of such majo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd