What is ionic bonds, Biology

Assignment Help:

What is Ionic bonds ?

Ionic Bonds :  Ionic bonds hold atoms together in crystals. They form when oppositely charged atoms, or ions, join (opposite charges attract) to equalize the overall charges, resulting in the formation of an ionic compound.

Ions are formed when an atom or group of atoms gains or loses electrons. Normally, the number of an atom's negatively charged particles equals the number of positively charged particles, and the sum of the charges for the atom is neutral. When an atom, usually a nonmetal, attracts an extra electron or electrons in order to become more stable, it becomes an ion. Positively charged ions are called cations, and negatively charged ions are called anions. Atoms that lose negative electrons become more positive, and those that gain negative electrons become more negative.

Nonmetals typically have shells that contain 5, 6, or 7 electrons in their outer shells, and therefore require one, two, or three electrons to become more stable by filling the shell. Nonmetals tend to gain electrons. Metals, having one, two or three electrons in their outer shells usually tend to readily lose one or more electrons to become more stable themselves.

648_example of ionic bonding.png

In this example, a sodium atom loses an electron to become a positively charged ion (cation), while a chlorine atom gains an electron to become a negatively charged ion (anion). The two oppositely charged ions then join to form a neutral compount, NaCl, sodium chloride, commonly known as table salt.


Related Discussions:- What is ionic bonds

Explain the flexibility exercises and its examples, Flexibility Exercises a...

Flexibility Exercises and Examples In  flexibility exercises, movable joints allow one or more of the following types of movements. Flexion - Flexion decreases the joint ang

Phylum:Echinodermata , What classifies an animal into the Echinodermata phy...

What classifies an animal into the Echinodermata phylum?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the term kwashiorkor, Explain the term Kwashiorkor? The term Kw...

Explain the term Kwashiorkor? The term Kwashiorkor means the 'disease the first child gets when the second baby is born', that is, 'the sickness of the deposed child'. Thus, th

Define about anthropometric and physiological, Define about Anthropometric ...

Define about Anthropometric and Physiological? Various physiological and anthropometric measurements give us an indication of the present status of an individual based on which

Phylogeny and Evolution, While studying evolution, a student comes across a...

While studying evolution, a student comes across a cladogram that includes clades like amphibia, reptilia, aves, and mammalia. What must be the basal clade?

Explain measles, Measles Adults born after 1956 who have not received ...

Measles Adults born after 1956 who have not received 2 doses of live measles vaccine (not the killed vaccine that was commonly used in the 1960s) after their first birthday an

Which enzyme acts on pyruvate in mitochondria, Which enzyme acts on pyruvat...

Which enzyme acts on pyruvate in mitochondria and converts it to acetyl CoA?Name its components and cofactors associated with it. Pyruvate dehydrogenase complex acts on pyruvate

Transpiration the only way through which leaves lose water, Is the transpir...

Is the transpiration the only way through which leaves lose water? The Plants don't only lose water as vapor as by transpiration. Leaves also lose liquid water by a phenomenon

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd