What is ionic bonds, Biology

Assignment Help:

What is Ionic bonds ?

Ionic Bonds :  Ionic bonds hold atoms together in crystals. They form when oppositely charged atoms, or ions, join (opposite charges attract) to equalize the overall charges, resulting in the formation of an ionic compound.

Ions are formed when an atom or group of atoms gains or loses electrons. Normally, the number of an atom's negatively charged particles equals the number of positively charged particles, and the sum of the charges for the atom is neutral. When an atom, usually a nonmetal, attracts an extra electron or electrons in order to become more stable, it becomes an ion. Positively charged ions are called cations, and negatively charged ions are called anions. Atoms that lose negative electrons become more positive, and those that gain negative electrons become more negative.

Nonmetals typically have shells that contain 5, 6, or 7 electrons in their outer shells, and therefore require one, two, or three electrons to become more stable by filling the shell. Nonmetals tend to gain electrons. Metals, having one, two or three electrons in their outer shells usually tend to readily lose one or more electrons to become more stable themselves.

648_example of ionic bonding.png

In this example, a sodium atom loses an electron to become a positively charged ion (cation), while a chlorine atom gains an electron to become a negatively charged ion (anion). The two oppositely charged ions then join to form a neutral compount, NaCl, sodium chloride, commonly known as table salt.


Related Discussions:- What is ionic bonds

Name the various suturing techniques, Name the various suturing techniques ...

Name the various suturing techniques There are a various suturing techniques each suited for a particular situation. Few of the common suturing techniques are mentioned here

Transportation of gases in tracheophytes vascular tissues, Is the transport...

Is the transportation of gases in tracheophytes made through the vascular tissues? The Carbon dioxide and The Oxygen are not transported through the xylem or phloem. These gase

Ornithine-urea cycle, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain surgery process for head and neck tumor, Define Surgery Process for...

Define Surgery Process for Head and Neck Tumor? Treatment mostly involves combination of surgery and radiation. Chemotherapy is also used in some cases, we will learn about the

What is the major constituent of the cell wall of bacteria, Q. According to...

Q. According to their morphology how bacteria are classified? Bacteria present different morphological patterns, a bacterium can be classified into bacillus, coccus, spirochete

Define disadvantages of using yeast as a source of protein, Define Disadvan...

Define Disadvantages of using yeast as a source of protein? 1. Less protein yield (45-60%) 2. Growth rate is low (1-3 h) 3. High nucleic acid content leading to the forma

Taxonomy, Write two cytological approaches in taxonomy.

Write two cytological approaches in taxonomy.

Animal classification, Explain metachrosis in frogs? How it is different fr...

Explain metachrosis in frogs? How it is different from change of skin colour of chemleon?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Does the dna replication occur in the cell division, Q. Does the DNA replic...

Q. Does the DNA replication occur in the cell division? Yes. The DNA replication occurs in mitosis as well in the meiosis.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd