Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is inharmonious ecological interaction?
The Inharmonious or negative ecological interaction is that in which at least one of the participating beings is harmed.
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What are the hyphae and the mycelium of pluricellular fungi? The major structures of pluricellular fungi are the hyphae (threadlike filaments made of contiguous uni or multinuc
Explain about Ridge mapping Ridge relationship is also critical especially in cases with multiple implants and fixed prosthesis, which is an advanced treatment procedure. But,
Patters of Cleavage In most of the animal groups with spherical or almost spherical egg and little or moderate amount of yolk (micro-or mesolecithal eggs), the first and seco
What are sori? The word "sori" is the plural form of "sorus". In ferns, a sorus (pl. sori) is a cluster of sporangia on the edge or underside of a fertile frond. In lots of spe
Explain assessment of iron status - Serum Ferritin? Serum Ferritin: This method is indicative of iron stores. As we know, a long term negative iron balance first results in dep
An A=T mispairing leads to an A=C substitution. The other DNA helix will contain a(n) __ pair. a. A=C b. A=T c. G=C d. B=Q e. T=T Can you also explain it please so if I'm ask
Cnidaria and Platyhelminthes - Larval forms Cnidaria The common larval stage that is found in cnidarians is the planula which forms following gastrulation. The planula is
Q. Food texture and Gas formers? Food texture: Recent studies indicate that strict omission of fibre is of no help on a peptic ulcer patient. The recurrence of peptic ulcer was
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd