What is inharmonious ecological interaction, Biology

Assignment Help:

Q. What is inharmonious ecological interaction?

The Inharmonious or negative ecological interaction is that in which at least one of the participating beings is harmed.


Related Discussions:- What is inharmonious ecological interaction

Nephridia of worms, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What are the hyphae and the mycelium of pluricellular fungi, What are the h...

What are the hyphae and the mycelium of pluricellular fungi? The major structures of pluricellular fungi are the hyphae (threadlike filaments made of contiguous uni or multinuc

Explain about ridge mapping, Explain about Ridge mapping Ridge relation...

Explain about Ridge mapping Ridge relationship is also critical especially in cases with multiple implants and fixed prosthesis, which is an advanced treatment procedure. But,

Patters of cleavage, Patters of Cleavage In most of the animal groups...

Patters of Cleavage In most of the animal groups with spherical or almost spherical egg and little or moderate amount of yolk (micro-or mesolecithal eggs), the first and seco

What are sori, What are sori? The word "sori" is the plural form of "so...

What are sori? The word "sori" is the plural form of "sorus". In ferns, a sorus (pl. sori) is a cluster of sporangia on the edge or underside of a fertile frond. In lots of spe

Explain assessment of iron status - serum ferritin, Explain assessment of i...

Explain assessment of iron status - Serum Ferritin? Serum Ferritin: This method is indicative of iron stores. As we know, a long term negative iron balance first results in dep

An a=t mispairing leads to an a=c substitution, An A=T mispairing leads to ...

An A=T mispairing leads to an A=C substitution. The other DNA helix will contain a(n) __ pair. a. A=C b. A=T c. G=C d. B=Q e. T=T Can you also explain it please so if I'm ask

Cnidaria and platyhelminthes - larval forms, Cnidaria and Platyhelminthes -...

Cnidaria and Platyhelminthes - Larval forms Cnidaria The common larval stage that is found in cnidarians is the planula which forms following gastrulation. The planula is

Food texture and gas formers, Q. Food texture and Gas formers? Food tex...

Q. Food texture and Gas formers? Food texture: Recent studies indicate that strict omission of fibre is of no help on a peptic ulcer patient. The recurrence of peptic ulcer was

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd