What is gluconeogenesis, Biology

Assignment Help:

What is gluconeogenesis

There is accumulation of lactate, which is released into the blood and taken up by  the liver where  it  is converted to glucose by  the  process called gluconeogenesis

 


Related Discussions:- What is gluconeogenesis

Explain about chthalamus, Explain about chthalamus The realised niche o...

Explain about chthalamus The realised niche of Chthalamus is reduced from its fundamental niche and it is limited to the upper tidal zone Lower  limits Out-competed

Mollusca, in molluscathe foot is used for (capturing locomotion or both

in molluscathe foot is used for (capturing locomotion or both

Excitation of heart - circulation, Excitation of Heart - Circulation T...

Excitation of Heart - Circulation The heart has an inherent capacity to contract rhythmically without any external stimulus. Proof of this is obtained when we see that the hea

Explain pyridoxal phoshphate, Pyridoxal phoshphate Pyridoxal  phosphate...

Pyridoxal phoshphate Pyridoxal  phosphate  is  derived  from  pyridoxine  (vitamin  B6)  and  is involved in amino acid metabolism.  The  other  two  compounds,  pyridoxal  and

What is a biologic failure, What is A biologic Failure A biologic Fail...

What is A biologic Failure A biologic Failure can be defined as the inadequacy of the host to establish or to maintain osseointegration. The inability to establish osseoint

Pre-operative nursing management of cardiac surgical patient, PRE-OPERATIVE...

PRE-OPERATIVE NURSING MANAGEMENT OF CARDIAC SURGICAL PATIENTS Cardiac surgical patients generally get investigated thoroughly before getting referred to the surgeons. Many of

The human foetus expelled from the uterus of its mother, How is the human f...

How is the human foetus expelled from the uterus of its mother: The total time required for the embryonic and foetal development is called gestation period which is usually

What is density-dependent and density-independent factors, What is Density-...

What is Density-dependent and density-independent Factors? Density-dependent : Ecologists identify population-regulating mechanisms whose functioning is related to density a

Silent myocardial ischaemia, Q. Silent Myocardial Ischaemia? Ans. ...

Q. Silent Myocardial Ischaemia? Ans. This deals primarily with those who have never had symptoms recognized as being of cardiac origin. Others, who have had recognized myo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd