Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is gluconeogenesis
There is accumulation of lactate, which is released into the blood and taken up by the liver where it is converted to glucose by the process called gluconeogenesis
Response to Heavy Metal Stress Several heavy metals emanating from industrial mining and sewage disposal operations contaminate the environment. Cadmium is a common contamina
Define Precautions for Acid Fast Staining? 1. Do not allow carbol fuchsin to dry on heating. 2. Maintain aseptic conditions. 3. Decolourization should be done till no red
Q. What are the physiological systems known as integrative systems? Why is this designation justified? The integrative systems are the endocrine system and the nervous system.
Differance between pulsus bigerniny or trigeminy and presence of bruit ? Pulsus bigerniny or trigeminy: After every 2nd or 3rd beat respectively there will be a longer inter
Which are the molecules that make possible active transport through membranes? Active transport is made by exact membrane proteins. These proteins are called "pumps" because
Explain about thiol proteases Group of thiol proteases, similar in structure to each other, are found in plants. These include papain from the papaya fruit and ficain from f
Which of the following statements about peptide bonds are true? Peptide bonds are amide linkages Peptide bonds form from nucleophillic attack by an electron pair on an alpha-
what are the two alternate pathways to glycolysis
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Approach grafting In this method both scion and stock remain rooted. A small slice is cut off from the stem of scion and stock. Scion is bent towards the stock. The two c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd