Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is genetic equilibrium?
The Genetic equilibrium is the result of the Hardy-Weinberg law, a principle that affirms that under specific conditions the frequencies of the alleles of a gene in a given population remain constant.
(The Hardy-Weinberg principle isn't valid in the following conditions for populations too small, in the occurrence of noncasual (driven) crossings, for populations with many infertile members and in case of action of evolutionary factors, like natural selection, migrations and mutations.)
List er i o si s The disease is caused by Listeria monocytogenes - Gram positive small non spore- forming bacilli seen in soil, silage, sewage and feces of animals and b
what are the kinds of tetrasporic embryo sac...detail information
Explain Water - An Essential but Overlooked Nutrient? You may already know that the total body water (TBW) constitutes 50-60% of the body weight. A 70 kg 'standard male' contai
Define the Prevalence and Incidence of bulimia nervosa? Bulimia nervosa appears to have become more prevalent during the past 30 years. We do not have much data on Indian popul
describe the different types of genomes that viruses can have
Bomb calorimeter is used to determine the calorific value of solid and liquid fuels. Construction It consists of following parts 1. Stainless steel bomb:
An egg osmometer Place some dilute hydrochloric acid or strong vinegar in a shallow dish, likeas a saucer, to a depth of about one centimetre. Hold the large end an egg in the
What is a biome? A biome is a prevailing ecosystem constituted by same biotic and abiotic factors present in one or more regions of the planet.
What is crossing over? How is meiosis related to this phenomenon? Linked alleles, for instance, A-b and a-B, form the gametes A-b and a-B that maintain the linkage of the allel
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd