Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is extracellular digestion?
Extracellular digestion is so that in which food breaking into utile molecules that can be internalized by the cell is done in the extracellular space that is outside the cell. In extracellular digestion, the cells secret substances that break big molecules into smaller ones in the external environment later the cell can benefit from these products of digestion.
are protozoans primitive to life .
Animals vs Plants Organisms are of two main types animals and plants, although all the above mentioned Unifying concepts of Biology apply equally to both animals and plants, ye
What are the types of digestion and of digestive system of platyhelminthes? Flatworms have incomplete digestive systems and they show intracellular and extracellular complement
E g g drop syndrome-76 (EDS-76) An outbreak of sudden drop in egg production or a failure to achieve a normal peak in production despite optimum managemental and nutrition st
DIFFERENCE S BETWEEN MEDULLATED AND NON-MEDULLATED NERVE FIBRES 1. Medullated (Myelinated) Nerve Fibres Medullary sheath is present.
What are the Body Fat Measurements? Obesity is best classified in adults based on Body Mass Index (BMI) classification. BMI, you already know, is a measure of body jut based on
Coronal Disassembly - If the existing restoration with marginal defect: - The crown was sectioned through the bucco-occlusaly , Christensen crown remover elevate and remove
Disorders of motor neurons and the spinal cord A number of movement disorders are produced by damage either to the spinal cord or to cortical projections to the spinal cord. Th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Saquinavir Saquinavir (SQV, Fortovase, Invirase) - When administered as a single protease inhibitor, a soft-gel preparation (Fortovase) with improved bioavailability an
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd