What is extracellular digestion, Biology

Assignment Help:

Q. What is extracellular digestion?

Extracellular digestion is so that in which food breaking into utile molecules that can be internalized by the cell is done in the extracellular space that is outside the cell. In extracellular digestion, the cells secret substances that break big molecules into smaller ones in the external environment later the cell can benefit from these products of digestion.


Related Discussions:- What is extracellular digestion

Zoogly, are protozoans primitive to life .

are protozoans primitive to life .

Animals vs plants, Animals vs Plants Organisms are of two main types an...

Animals vs Plants Organisms are of two main types animals and plants, although all the above mentioned Unifying concepts of Biology apply equally to both animals and plants, ye

What are the types of digestion, What are the types of digestion and of dig...

What are the types of digestion and of digestive system of platyhelminthes? Flatworms have incomplete digestive systems and they show intracellular and extracellular complement

Egg drop syndrome-76 (eds-76), E g g drop syndrome-76 (EDS-76) An out...

E g g drop syndrome-76 (EDS-76) An outbreak of sudden drop in egg production or a failure to achieve a normal peak in production despite optimum managemental and nutrition st

Difference between medullated and non-medullated fibres, DIFFERENCE S BETW...

DIFFERENCE S BETWEEN MEDULLATED AND NON-MEDULLATED NERVE FIBRES       1. Medullated (Myelinated) Nerve Fibres Medullary sheath is present.

What are the body fat measurements, What are the Body Fat Measurements? ...

What are the Body Fat Measurements? Obesity is best classified in adults based on Body Mass Index (BMI) classification. BMI, you already know, is a measure of body jut based on

Coronal disassembly with marginal defect, Coronal Disassembly - If the ...

Coronal Disassembly - If the existing restoration with marginal defect: - The crown was sectioned through the bucco-occlusaly , Christensen crown remover elevate and remove

Disorders of motor neurons and the spinal cord, Disorders of motor neurons ...

Disorders of motor neurons and the spinal cord A number of movement disorders are produced by damage either to the spinal cord or to cortical projections to the spinal cord. Th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain saquinavir, Explain Saquinavir Saquinavir (SQV, Fortovase, Invi...

Explain Saquinavir Saquinavir (SQV, Fortovase, Invirase) - When administered as a single protease inhibitor, a soft-gel preparation (Fortovase) with improved bioavailability an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd