What is energy, Biology

Assignment Help:

What is Energy ?

Energy

Energy is defined as the capacity to do work. Work is defined as the movement of a mass, or the product of the force and the distance through which the mass was moved. Like matter, energy is essentially neither created nor destroyed, but only converted from one form to another. Different forms of energy include mechanical, heat, light, electrical, chemical, and nuclear energy.

Energy comes can be classified as either potential energy, stored in one configuration of atoms or position of matter in space, or kinetic energy, which by virtue of its motion, such as that of a falling body, can do work.

Heat energy is measured in calories. One calorie is equal to the amount of heat required to raise the temperature of one gram of water one degree, from 14.50C to 15.50C. One Calorie = 1000 calories = 1 kilocalorie or Kcal. The energy values of foods are measured in Calories.

Atoms and molecules in all matter are in constant motion, bouncing off of each other with kinetic energy that varies with heat and other forces. Particles of solids are closely bound and have less kinetic energy than those of liquids, which in turn have less than those of gases.

For any chemical reaction to occur, energy available to do work, or free energy, must be present. If an input of energy is required, the reaction is called endergonic; if the energy supplied is in the form of heat, it is also referred to as endothermic. Other reactions occur spontaneously and free energy is released as an output; these reactions are called exergonic. If the energy is released in the form of heat, they are exothermic. The amount of energy that must be supplied to complete a reaction is called the activation energy. Energy stored in a chemical bond is released when the bond is broken.


Related Discussions:- What is energy

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Does thermal inversion occur in the winter or in the summer, Does thermal i...

Does thermal inversion occur in the winter or in the summer? Pollutant low altitude thermal inversion happens in the winter. In this period of the year the sun heats the soil l

The human impact on the environment, what are the principle sources of exce...

what are the principle sources of excessive nitrate and phosphate in rivers and lakes?

What is lysosomes, What is Lysosomes? Lysosomes :  Animal and fungal ...

What is Lysosomes? Lysosomes :  Animal and fungal cells contain membrane-bound organelles called lysosomes, which are filled with digestive enzymes. These digestive enzyme

Metabolism, METABOLISM  - Word given by Shwann . It includes bio-ch...

METABOLISM  - Word given by Shwann . It includes bio-chemical reactions occur in body may be constructive or destructive. It includes -                         Anabo

Biology in dispelling myths and misbeliefs, BIOLOGY IN DISPELLING MYTHS AND...

BIOLOGY IN DISPELLING MYTHS AND MISBELIEFS - Varieties of myths still exist in our society, and can be removed by the knowledge of Biology. Some of these are- 1.       Snake

Why is a leguminous crop rotation used in agriculture, Q. Why is a legumino...

Q. Why is a leguminous crop rotation used in agriculture? The Leguminous crop rotation and other crop rotations are used in agriculture for the reason that in these plants many

Organic compounds, ORGANIC COMPOUNDS - They are substances having bo...

ORGANIC COMPOUNDS - They are substances having both carbon and hydrogen which are commonly biological in origin. Organic compounds can be micromolecules or macromolecules

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd