Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is digestion?
Digestion is the breaking down of larger organic molecules obtained from the diet, e.g. carbohydrates, fats, proteins, into smaller ones, as glucose, fatty acids, glycerol and amino acids.
the model
What is ancylostomiasis? Ancylostomiasis is a disease caused by Ancylostoma duodenale or Necator americanus, both hookworms belonging to the nematode phylum (roundworms). Ancyl
Explain Keshan disease caused by Selenium deficiency? It is a cardiomyopathy (disease of the myocardium, involving heart muscle) that was identified to affect children and wome
Q. What are instances of nematodes? Ascaris, filaria and hookworm, all parasites of humans, are instance of nematodes also known as roundworms. Q. Are nematodes exclusively
Yabapox Yabapox is a disease affecting mangabeys, rhesus, cynos, vervets, stumptails, and patas monkeys. It is caused by the Yaba-like disease virus (YLDV) and Yaba monkey tumor v
Q. Are body planes important for identifying anatomical structure? In order to observe and study structural arrangement of the internal organs, body may be divided and sectione
Cutaneous respiration in frogs and toads
At the present level of the biotechnology what are the main techniques of genetic engineering? The major techniques of genetic engineering today are: the recombinant DNA techno
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Movement is even controlled by organelles, cilia and flagella. These and the pseudopodia in the amoebas give these small creatures movement, something we associate with animals. Es
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd